it s a rasterized world exploring the two types of graphics

It’s a mobile world   9+1 learnings to build a path to success

It’s a mobile world 9+1 learnings to build a path to success

Ngày tải lên : 30/11/2015, 10:41
... FMCG Transportation Destinations Retail LAST  3  MONTHS  ACHIEVEMENTS LAY S  GLOBAL  DIGITAL  STRATEGY BEST  APPROACH  TO  CONSIDERATION   IN  AUTOMOTIVE  INDUSTRY BEST  ONLINE  BUSINESS  MODEL ... Digital Performance Into Great Results Digital Strategy & Advisory Consumer Behavior Analysis Content Marketing Reputation Management 30 Countries 132 Beloved Brands Our Expertise After 10 Years ... LET S  GET  TO  KNOW  EACH  OTHER   I  BELIEVE  IN THE  GOD OF   DATA  AND  MARKETING :-­) hello! XPLAIN.co The Digital Marketing Auditors and Advisors XPLAIN.co We Transform Brands’ Poor Digital...
  • 75
  • 247
  • 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Ngày tải lên : 21/02/2014, 08:20
... city General Quitman 's troops, from the Belen Gate, had passed the abandoned citadel, reached the Main Plaza, and took possession of the National Palace Later, General Scott, with his staff officers ... request that Captain Swift be taken as soon as practicable, to the steamer which was the headquarters of General Scott That request was promptly complied with; but the Captain 's vitality was exhausted ... L Smith, senior engineer, says: "Lieutenant Stevens in the reconnaissance of the position of Churubusco, was assisted by Lieutenant McClellan and escorted by the company of sappers and miners...
  • 48
  • 504
  • 0
Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

Ngày tải lên : 08/08/2014, 12:23
... as the graph shown in Figure 2(b).) s s s s s s ds   (a) s s s s r ¨¨ s r s r ds   (b) s s s s s s ds   (c) s s s r s r s rs ds   (d) s s s s r ¨¨ s r s r ds   (e) s s s r s r s rs ds   (f ) ... s s s u s s s s ds   s s Figure 6: A graph G in the family G 3.8 Sharpness of Corollary To illustrate the sharpness of Corollary 5, let k ≥ be an integer and let H be the family of all graphs ... three-eights its order the electronic journal of combinatorics 18 (2011), #P12 10 u   s ds s s s s s ds u u $ $u s s s $ u $$ d s   e   e  d s e s s e s s eu ds   s s s ds   u ds s   s u ¨u ¨   s ds ¨ s...
  • 35
  • 259
  • 0
báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx

báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx

Ngày tải lên : 10/08/2014, 10:23
... DSM-IV-TR: Diagnostic and Statistical Manual of Mental Disorders The American Psychiatric Association, 2000 Francis J, Kapoor WN: Prognosis after hospital discharge of older medical patients ... postings and using snowball sampling Participation was considered to be implied consent Focus group participants were asked about facilitators and barriers to using the pathway, ease of use, and ... data collection and management We also thank Kelly McDonald (Alberta Health Services) and Rishma Jessa (Alberta Health Services) for assisting with the CAM education and order set implementation,...
  • 6
  • 226
  • 0
báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt

báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt

Ngày tải lên : 11/08/2014, 14:21
... setting may not work in others [52] The majority of these studies of access have focused on healthcare generally rather than HIV/AIDS services specifically The last decade has seen an increase ... outside larger towns/cities, qualitative data point to substantial local variations in geographical accessibility For example, clients living outside Odessa and Osh explained that distance was a ... we argue that it is essential to understand country contexts rather than assume access problems are universal across different settings, disease areas, client groups and service provider types...
  • 15
  • 477
  • 0
cafferty - it's getting ugly out there; the frauds, bunglers, liars, and losers who are hurting america (2007)

cafferty - it's getting ugly out there; the frauds, bunglers, liars, and losers who are hurting america (2007)

Ngày tải lên : 01/11/2014, 12:12
... ashamed of being in the media All of this garbage can’t help but contribute to a pervasive spirit of narcissistic entitlement that, in turn, disengages us from the issues at the heart of It s ... that day was Afghanistan s ruthless Taliban and their al-Qaeda confederates Yet over the course of his presidency, by conflating 9/11 and Saddam and by transforming Iraq into a de facto Islamic ... families with alcoholics Part of it for him was the celebrity and part of it was the attention he got outside the home Another part was the money Anyone who s an alcoholic starts out with a great...
  • 288
  • 194
  • 0
economics - freakonomics - a rogue economist explores the hidden side of everything - s d levitt & s j d~0

economics - freakonomics - a rogue economist explores the hidden side of everything - s d levitt & s j d~0

Ngày tải lên : 04/11/2014, 15:40
... will ask a lot of questions, some frivolous and some about life-and-death issues The answers may often seem odd but, after the fact, also rather obvious We will seek out these answers in the data—whether ... U .S congressional races since 1972 What the numbers have to say about such cases? Here s the surprise: the amount of money spent by the candidates hardly matters at all A winning candidate can ... within any one student s exam—such as getting the hard questions right while missing the easy ones—especially when measured against the thousands of students in other classrooms who scored similarly...
  • 257
  • 281
  • 0
The Two Lovers of Heaven

The Two Lovers of Heaven

Ngày tải lên : 06/11/2012, 15:30
... from his master Now there is a great conflict of opinion as to the precise degree of merit which these particular Spanish dramas possess Speaking as an ignorant man, I should say, whilst those who ... internally and externally too many sources of inspiration to necessitate an adoption even of such high models as the Spanish Autos Besides, The Dream of Gerontius is no more an Auto than Paradise ... business a little better, we may examine them impartially together Nay, even as it is, Calderon stands so indisputably at the head of all Catholic religious dramatists, among whom Dr Newman has...
  • 11
  • 421
  • 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20
... learning, and discovery, its contributions to national and global politics and culture, and its inevitable controversies and scandals University Oars University Oars is a compilation of letters of response ... pastimes, exist rather in the timid brains of alarmists than in the stern tables of statistical investigation Having thus discussed the different cases in which health is said to have suffered ... in the Bay of Biscay, another was drowned in swimming a young horse across a river in Australia, another was murdered by poachers, and another accidentally shot Turning from these casualties,...
  • 419
  • 541
  • 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Ngày tải lên : 18/02/2014, 01:20
... University of Arkansas Jan R Williams Dean, The University of Tennessee & AACSB International Chair The Association to Advance Collegiate Schools of Business Jack E Wilkerson, Jr Professor of Accountancy ... of Law San Francisco: Jossey-Bass, 2007 Sundem, G., Sarasota, FL: AECC and AAA, 1999 Taylor, M “Paths to Professions: Schools, Businesses Focus on Critical Thinking.” The Wall Street Journal September ... domestic and global economies Accountants may use their skills and talents to assist management in understanding and monitoring the operations of businesses and other organizations and in facilitating...
  • 140
  • 391
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Ngày tải lên : 18/02/2014, 16:20
... and mass accuracy capabilities approaching those of FT MS, with very promising cost advantages [33] ECD and electrontransfer dissociation are less sensitive than CAD or IRMPD, in part because they ... This shows that these identifications are reversed, an error that does not affect the molecular mass value and a sequence consistent with those of sheep and human carbonic anhydrases A thaliana [20], ... RNase A deamidation samples of Fig Deamidation at an individual residue of a specific product causes a Da increase in any fragment ion containing that residue The average mass gain of N-terminal...
  • 13
  • 572
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Ngày tải lên : 19/02/2014, 16:20
... No steady states exist on the borders of the phase space This is the necessary condition for sustained oscillations to be observed in this system The stability of the steady states was analyzed ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this ... analysis of conditions necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the...
  • 11
  • 638
  • 0
Tài liệu A NOTE ON MEASURING THE ECONOMIC IMPACT OF INSTITUTIONS OF HIGHER EDUCATION ppt

Tài liệu A NOTE ON MEASURING THE ECONOMIC IMPACT OF INSTITUTIONS OF HIGHER EDUCATION ppt

Ngày tải lên : 20/02/2014, 19:20
... investment in a university A diagram of this process is presented in Figure Bluestone noted that the skill-base approach is particularly useful in the case of the University of Massachusetts at Boston ... had appropriate employment been found within the state." These studies suggest that increases in the skill base cannot affect a state 's economy unless appropriate jobs are available to the graduates ... than other states? Or, does the location of a university affect the average level of skills in an area? If rigidities in the economy cause the average level of skills to rise near universities,...
  • 12
  • 500
  • 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Ngày tải lên : 21/02/2014, 03:20
... copper sulfate solution The amount of synthetized ATP was evaluated by adding 10–25 nM standard ATP ATP synthesis induced by acid-base transitions Acid-base driven ATP synthesis was carried out similarly ... colorimetric assay as described previously [38] For more sensitive measurements, the released Pi was measured with the EnzCheck Phosphate Assay Kit (Molecular Probes) or with the malachite green assay ... measuring the ATP synthesis activity of ATP synthases incorporated into liposomes [45,46] Figure shows some of the traces obtained by this method The initial high rates of ATP synthesis decay...
  • 9
  • 580
  • 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Ngày tải lên : 06/03/2014, 21:20
... payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of accruals – income the organisation has received for goods or services it has not ... the financial condition of the organisation Financial analysis shows the ‘reality’ of the situation of an organisation – and as such, is one of the most important practices in management This guide ... time, the balance sheet depicts the overall status 15 Fundamentals of NGO Management of the organisation s finances at a fixed point in time – usually at the end of its financial year All assets are...
  • 76
  • 577
  • 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Ngày tải lên : 07/03/2014, 21:20
... mutants and RNAi mutants of A thaliana homologs of OsRPA7 0a and OsRPA70b (AtRPA7 0a and AtRPA70b) A thaliana was used for genetic analysis of the functions of OsRPA7 0a and OsRPA70b because it has ... phosphate as substrates [33] A thaliana T-DNA insertion mutant analysis A thaliana lines with T-DNA insertions in atrpa7 0a (SALK017580) and atrpa70b (SALK088429) were obtained from The Salk Institute ... (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b As a control, A thaliana putative 4 0S ribosomal...
  • 12
  • 588
  • 0
Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx

Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx

Ngày tải lên : 07/03/2014, 21:20
... functions of homoadenosylcobalamins M Fukuoka et al A B Fig Modeling studies of diol dehydratase on adenosyl radical formation and access to substrate (A) and partial structures of AdoCbl analogues ... concentrations (0–10 lm) of AdoCbl The alcohol dehydrogenase-NADH coupled assay method [55] was also used for the assays of both diol dehydratase and ethanolamine ammonia-lyase The reaction mixture ... in the distances between substrate radical and Co(II) may cause different ways of radical transfer from coenzyme to substrate For the access to substrates, ribosyl rotation (Fig 1A) and pseudorotation...
  • 10
  • 444
  • 0
Establishing a New Research University: The Higher School of Economics, the Russian Federation docx

Establishing a New Research University: The Higher School of Economics, the Russian Federation docx

Ngày tải lên : 08/03/2014, 06:20
... within a few specific research areas This step was critical because these teams are to disseminate these standards in other research areas No such capacity was available in other segments of socioeconomic ... world- class research university model has been the attraction of talented teachers and researchers HSE has faced a lack of specialists available in Russia in some subject areas Therefore, different approaches ... universities was US$100–120 This salary was much lower than a starting salary for many university graduates As a result, practically every professor had to take several jobs and visit his or her base...
  • 29
  • 287
  • 0