it s a quantitative variable is just wrong
It’s a mobile world 9+1 learnings to build a path to success
Ngày tải lên :
30/11/2015, 10:41
... Digital Performance Into Great Results Digital Strategy & Advisory Consumer Behavior Analysis Content Marketing Reputation Management 30 Countries 132 Beloved Brands Our Expertise After 10 Years ... FMCG Transportation Destinations Retail LAST 3 MONTHS ACHIEVEMENTS LAY S GLOBAL DIGITAL STRATEGY BEST APPROACH TO CONSIDERATION IN AUTOMOTIVE INDUSTRY BEST ONLINE BUSINESS MODEL ... ARE USING MOBILES EVERY MINUTE THERE IS NOT OFFLINE AND ONLINE COMMUNICATION I KNOW! MOST OF TRADITIONAL MARKETERS SAY SO BECAUSE THEY ARE TRADITIONAL! REAL LIFE IS...
- 75
- 247
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... parameters were set according to the manufacturer s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA ... other hand, Freitag et al., based on multivariate models adjusting for known risk factors, showed that elevated plasma BNP levels were associated with an increased risk of blood pressure progression ... systemTM; Agilent Technologies, Waldbronn, Germany) Int J Med Sci 2007, Statistical analysis Data are presented as the mean ± SD The Hardy-Weinberg equilibrium was assessed by doing chi-square...
- 7
- 612
- 1
Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx
Ngày tải lên :
16/02/2014, 11:20
... Economic Analysis, Federal Reserve Board, author s calculations of consumer durable goods by households as personal consumption expenditures has been a cause of dissatisfaction: At least a portion ... savings was largely an artifact of measurement problems Parker (2000, p 322) stresses that NIPA accounts a very ambiguous job at separating household savings from business savings This may justify ... personal saving rate was negative See Nakamura and Stark (2005) for a discussion Garner (2006, p 16) anticipated an upward revision of the NIPA saving rate because the U .S Census Bureau has revised...
- 24
- 500
- 0
Tài liệu It’s All in a Day’s Work docx
Ngày tải lên :
11/12/2013, 02:15
... uses open-source software for mission-critical applications Don’t Take My Word For It A great idea is always backed (or dispelled) by a set or solid, hard data In SourceLabs’ case, this was a ... with archives from within PHP is both possible and quite easy it is just not as documented and talked-about as other aspects of the language There are several possible ways to use archives, and all ... // Set up the warnings area $this->warningsArea =& new GtkText(); $this->warningsArea->set_editable(false); $this->warningsArea->set_word_wrap(false); // Add a button to clear the warnings area...
- 66
- 587
- 0
Tài liệu It’s All in a Day’s Work ppt
Ngày tải lên :
17/01/2014, 18:20
... uses open-source software for mission-critical applications Don’t Take My Word For It A great idea is always backed (or dispelled) by a set or solid, hard data In SourceLabs’ case, this was a ... with archives from within PHP is both possible and quite easy it is just not as documented and talked-about as other aspects of the language There are several possible ways to use archives, and all ... // Set up the warnings area $this->warningsArea =& new GtkText(); $this->warningsArea->set_editable(false); $this->warningsArea->set_word_wrap(false); // Add a button to clear the warnings area...
- 66
- 649
- 0
It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market
Ngày tải lên :
09/02/2014, 20:53
... course, the privacy is great But still, I guess it s not as important as a good salary and benefits package, and a short commute.” Know thyself, Socrates said, and that s particularly good advice ... it as laziness or a lack of real interest Instead, use the company s words as a starting point for your own ideas and enthusiasm, as in: “I really like that ABC Company s mission includes, a ... (“Strongest possible,” by the way, means HIAPiest and most enthusiastic.) Smart HIAPy candidates never stop tweaking their applications so that the framing is as powerful as possible Framing is...
- 48
- 560
- 0
Tài liệu Is the long-term interest rate a policy victim, a policy variable or a policy lodestar? docx
Ngày tải lên :
17/02/2014, 03:20
... Treasury bill rate Sources: DataStream, National data; BIS calculations Table Floating rate issuance of AAA-rated securities by sector As a % of total AAA issuance Sovereign ABS Mortgage institutions ... debts led to a dramatic shrinkage in ABS issuance Yet the crisis itself also paradoxically favoured alternative AAA-rated paper Because banks found it harder to issue unsecured debt in capital markets, ... Incentives for interest rate carry trades Graph The propensity to save in developing Asia Graph Issuance of AAA-rated securities Graph Issuance of AAA-rated securities fixed-rate Graph Maturity of US...
- 39
- 514
- 0
Shooting for Tiger How Golf’s Obsessed New Generation Is Transforming a Country Club Sport pptx
Ngày tải lên :
08/03/2014, 20:20
... Although Americans dominate junior tournaments, Europeans and Asians are increasingly visible at AJGA events As golf cast a spell over millions, it has spawned a serious backlash One criticism ... English-speaking countries such as Australia, and more recently to places as far removed as Sweden and Spain, and China and South Korea Today it s a global passion, with professionals from all ... echik s on golf clubs “We always have enjoyed commercial contacts with the Scots just across the North Sea, so it s not surprising we shared habits of ball games,” says Pieter Aalders, Kennemer’s...
- 287
- 332
- 0
Monetary Policy and the Slow Recovery: It’s Not Just About Housing ppt
Ngày tải lên :
23/03/2014, 05:22
... new cars, auto workers in Indiana may lose their jobs But, what is fascinating, and perhaps surprising, is this: The close relationship between the fall in home prices and state economic activity ... though, economists in the structural camp argue that the natural rate has risen substantially, largely because of the labor market mismatches I described The idea is that a lot of people are unemployed ... have a top-notch credit rating and the cash to make a substantial down payment Uncertainty is a second factor holding back the recovery Businesses, investors, and households remain skittish, even...
- 15
- 490
- 0
Lower-Calorie Foods It’s Just Good Business pdf
Ngày tải lên :
23/03/2014, 05:22
... quintessential example of a QSR For purposes of this analysis, Panera Bread, oftentimes considered a Fast Casual chain, is included in this class of restaurants Sit-Down Restaurant: Casual dining ... and to help address high obesity rates Lower-Calorie Foods: It s Just Good Business Methodology Data Sources Categories Objectives Trinity Capital Same-Store Sales Change Financial Performance ... friendly The food, service and décor is superior to QSRs Olive Garden provides an example of a casual dining chain Total Sales: A measure of a restaurant Same-Store Sales (“SSS”): An Traffic: The number...
- 8
- 173
- 0
Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx
Ngày tải lên :
29/03/2014, 22:20
... types of IS audits This document distinguishes between IS cross-cutting audits and IS partial audits An IS cross-cutting audit has a holistic approach and a wide range of tests and examinations ... Association (ISACA), and international organisations such as the International Auditing and Assurance Standards Board (IAASB) or the Institute of Internal Auditors (IIA) These publications take ... the IS audit from the organisation s point of view 3.3 IS audit team For each IS audit, a suitable IS audit team is to be assembled The members of this IS audit team should possess the corresponding...
- 38
- 505
- 0
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx
Ngày tải lên :
30/03/2014, 09:20
... proteins Statistical analysis The software analyse it for Microsoft Excel, Version 1.73 (Microsoft, Redmond, CA), was used for statistical analyses P-values of < 0.01 obtained from t-test (two ... optical fiber and the tissue was ensured by means of a mm spacer tip After the spectroscopic measurements, tissue samples were collected for immunoblot analysis Photoconversion in live corals was ... the scleractinian corals M cavernosa, Scolymia cubensis, Catalaphyllia jardinei, the corallimorpharian Ricordia florida and the alcyonarian Dendronepthya sp [10,12,27] An unusual, green-to-orange...
- 10
- 487
- 0
theory of functions of a real variable - s. sternberg
Ngày tải lên :
31/03/2014, 15:23
... {x|d (A, x) = 0} consisting of all points at zero distance from A is a closed set It clearly is a closed set which contains A Suppose that S is some closed set containing A, and y ∈ S Then there is ... This is known as the parallelogram law It is the algebraic expression of the theorem of Apollonius which asserts that the sum of the areas of the squares on the sides of a parallelogram equals ... words, X/R is a metric space Clearly the projection map x → {x} is an isometry of X onto X/R (An isometry is a map which preserves distances.) In particular it is continuous It is also open In short,...
- 393
- 305
- 0
probability and finance it's only a game
Ngày tải lên :
31/03/2014, 16:24
... (Together with Axiom 1, this says that is an ulgebra of sets When is also closed under countably infinite intersections and unions, it is called a a-algebra.) To each set E in is assigned a nonnegative ... simplifying assumption that the game is terminating A strategy simulates a transaction satisfactorily for Skeptic if it produces at least as good a net payoff Table 1.2 summarizes how this applies to ... and selling a variable x As indicated there, P simulates buying x for a satisfactorily if K p x - a This means that > a > 40 - a When Skeptic has a strategy P satisfying Similarly, when he has...
- 417
- 426
- 0
A Healthy Distrust For Authority Why It’s Great For Your Internet Marketing Career By Jason pptx
Ngày tải lên :
27/06/2014, 23:20
... that go against conventional wisdom or what the gurus said Interesting Affiliate Marketing Is The Easiest Business Model! Wrong! Full disclosure - I just recently invited my friend PR God Marc ... this case, we use webinars instead What about services instead of info products? Then short copy - without a doubt - is the best way to go I sell a "sales letter re-write" service for $500 a ... Marc Harty to a webinar for my list and just by "hosting it" and having my assistant send out a couple emails - I ended up making somewhere close to $3000 Pretty good, huh? Yep, that was affiliate...
- 5
- 271
- 0
It''''s is said that...
Ngày tải lên :
11/07/2014, 21:00
... ………………………………………… It is considered that this surgeon is a brilliant practitioner → This surgeon………… ………………………………………… It is now thought that some redundancies in the company are inevitable (không thể ... → Some redundancies in the company…………………………… ………………………………………… It was proved that the statements he had made were false → The statements……… ………………………………………… It was understood that the delegation ... 47 They haven’t got your purse, ………………… ? 48 He is in a good temper today, ………………… ? 49 She concluded by saying that one s family always comes last, ………………… ? 50 She is never late for school,...
- 4
- 878
- 20
Báo cáo toán học: "A quantitative ergodic theory proof of Szemer´di’s e theorem" pot
Ngày tải lên :
07/08/2014, 13:21
... observe that the construction A → U AP [A] maps shift-invariant Banach algebras to shift-invariant Banach algebras: Proposition 5.4 If A is a shift-invariant Banach algebra, then so is U AP [A] ... fU AP is now constant and fU ⊥ and its shifts will have to be larger than, say, δ/2 with very high probability, say at least − 1/2k) Thus it remains to handle the d > cases We may assume as an ... Furthermore U AP [A] contains A, and f U AP [A] ≤ f A for all f ∈ A Finally, if A is scale-invariant then so is U AP [A] Remark 5.5 This is a quantitative analogue of the well known fact in ergodic...
- 49
- 239
- 0
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot
Ngày tải lên :
10/08/2014, 09:21
... tenting area were meaured using standard approaches in 2D from the vertical and horizontal long-axis Statistics Continuous variables were reported as mean ± SD Categorical variables were reported as ... echocardiography 2D transthoracic and/or transesophageal echocardiography was also performed for independent clinical assessment of AS All images were analyzed offline on semi-automatic MASS Plus and ... mean and peak transvalvular gradients, they were 53 and 78 mmHg, respectively; severe AS Page of variance (ANOVA) and repeated-measures ANOVA was performed for comparisons over time Statistical...
- 8
- 332
- 0