it comparison with a classical genetic scan matching technique
báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx
... RA SA Per PsA Ax PsA MH Controls RA SA Per PsA Ax PsA RE Controls RA SA Per PsA Ax PsA SF Controls RA SA Per PsA Ax PsA VT Controls RA SA Per PsA Ax PsA SF-36 PCS Controls RA SA Per PsA Ax PsA ... older age-matched healthy controls, the patients with AS will have a longer disease duration than those with RA or PsA The educational level among patients with RA was lower than among patients with ... patients (469 with RA, 164 with SA, 65 with axial PsA and 101 with peripheral PsA) accepted the invitation to participate by completing the questionnaires and the physical and radiological evaluation...
- 12
- 466
- 0
báo cáo hóa học:" Health-related quality of life in urban surgical emergency department patients: Comparison with a representative German population sample" docx
... PCS datasets were missing; therefore analysis was based on 6,836 consecutive patients Statistical analysis All binary and categorical variables are shown as frequencies Metric variables are shown ... of significance To compare PCS and MCS between emergency department patients and data in the German Federal Health Survey, a multifactor analysis of variance (ANOVA) was conducted with "setting", ... harmful alcohol consumption as well as male gender, older age and a high family income were positively associated with mental health Better physical health in ED patients was positively associated...
- 9
- 410
- 0
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx
... Univariate and multivariate Cox regression analyses of risk factors for late mortality† Risk factor HR late mortality Univariate analysis P value HR late mortality Multivariate analysis P value ... treated with medical management had a 43% 5-year survival rate as opposed to a 63% 5-year survival rate in the surgically treated patients Although CABG enables longer survival and a better quality ... reported a 9.3% 30-day mortality rate in patients with an EF of < 40% Christakis and colleagues [6] demonstrated a 9.8% operative mortality rate in patients with an EF of < 20%, and a study by Carr and...
- 8
- 358
- 0
báo cáo khoa học: "IsoBED: a tool for automatic calculation of biologically equivalent fractionation schedules in radiotherapy using IMRT with a simultaneous integrated boost (SIB) technique" ppt
... permits a comparison of the biologically equivalent schedules using hyper/hypo-fractionated as well as conventional regimes It also includes a database with the main DV- constraints at Gy per fraction ... 35 Pyakuryal A, Myint WK, Gopalakrishnan M, Jang S, Logemann JA, Mittal BB: A computational tool for the efficient analysis of dose-volume histograms for radiation therapy treatment plans J Appl ... Strigari L, Benassi M, Arcangeli G, Bruzzaniti V, Giovinazzo G, Marucci L: A novel dose constraint to reduce xerostomia in head-and-neck cancer patients treated with intensity-modulated radiotherapy...
- 11
- 402
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... k3 with cellular internalisation, and k4 with externalisation Besides the compartmental analysis, a non-compartmental model based on the fractal dimension was used The fractal dimension is a parameter ... distribution of tracer activity We used a subdivision of × and a maximal SUV of 20 for the calculation of fractal dimension [30] Statistical analysis Statistical evaluation was performed with Stata/SE 10.1 ... tomography (PET) and gene array data: a new approach for the correlative analysis of molecular biological and clinical data IEEE Trans Med Imaging 2007; 26:804–812 30 Dimitrakopoulou-Strauss A, ...
- 23
- 350
- 0
báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx
... limitation emotional Statistical analysis Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS) for Windows (version 14.0) Demographic and clinical variables ... covariates of GQOL like age, sex, education, marital status, clinical variables and health-focused QOL were adjusted for in the multivariate analysis Such adjustments allows for a more meaningful ... and reliability testing of the Quality of Life Scale, Swedish version in women with fibromyalgia – statistical analyses Scand J Caring Sci 2005, 19:64-70 Grov EK, Dahl AA, Fossa SD, Wahl AK, Moum...
- 11
- 514
- 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx
... and y(t) are the baseband equivalent PA input and output, respectively, a1 and a3 are real polynomial coefficients We assume an amplifier with a unity gain (a1 = 1) and an input amplitude at 1-dB ... a BER of 10−3 , the performance degradation is about dB for an ADC with bits With an additional bit, performance degradation becomes negligible CPM is less a ected by a low resolution ADC than ... is analyzed Simulation results are represented in Figure 14 For a BER of 10−3 , the performance degradations are about dB with an ADC of bits With one additional bit, the performance degradation...
- 14
- 350
- 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" doc
... and y(t) are the baseband equivalent PA input and output, respectively, a1 and a3 are real polynomial coefficients We assume an amplifier with a unity gain (a1 = 1) and an input amplitude at 1-dB ... a BER of 10−3 , the performance degradation is about dB for an ADC with bits With an additional bit, performance degradation becomes negligible CPM is less a ected by a low resolution ADC than ... is analyzed Simulation results are represented in Figure 14 For a BER of 10−3 , the performance degradations are about dB with an ADC of bits With one additional bit, the performance degradation...
- 14
- 313
- 0
THERE ONCE WAS A CLASSICAL THEORY: Introductory Classical Mechanics, with Problems and Solutions pdf
... be a tiny distance (small compared to a) Then a force F3 at a distance a is equivalent to a force F3 (a/ ) at a distance 11 But a force F3 (a/ ) at a distance is equivalent to a force F3 (a/ ... right Gravity Consider two point objects, with masses M and m, separated by a distance R Newton’s gravitational force law says that the force between these objects is attractive and has magnitude ... The laws are fairly intuitive, although it seems a bit strange to attach the adjective “intuitive” to a set of statements that took millennia for humans to write down The laws may be stated as...
- 623
- 464
- 0
Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf
... the accuracy of measurements was estimated Results showed a very high repetitivity with a variation coefficient of 0.1% These gaps are really non significative and can be explained by manual sample ... Nowadays, it is something already explained with wood anatomy in a previous work [7] A comparison between results obtained with pendulum (Fig 8), and results obtained with one of current formulations ... mechanical stresses depend on chip formation [11, 15, 16, 19], it appears clearly that, in routing, notions of crack propagations (with fracture toughness parameter), and cellular-wall mechanical...
- 7
- 323
- 0
Báo cáo lâm nghiệp:" Comparison of soil water-contents as measured with a neutron probe and time domain reflectometry in a " ppsx
... TDR, also obtained a higher bias with higher q values Finally, Salas Comparison between neutron probe and TDR Table III Summary of the ANOVA results (two-way ANOVA with paired-values): (a) Probe ... above sea level Climate: Humid Mediterranean Mean annual rainfall: 1580 mm a 1 Mean annual temperature: 10.4 ºC Potential evapotranspiration: 800 mm a 1 Bedrock: Paleozoic, schists, grauwackes ... The invaluable technical assistance Jesús Hernández and Miguel Tapia is acknowledged REFERENCES [1] Cermak J., Prax A. , Water balance of a southern Moravian floodplain forest under natural and modified...
- 9
- 353
- 0
Báo cáo khoa học: "Estimating tree canopy water use via xylem sapflow in an old Norway spruce forest and a comparison with simulation-based canopy transpiration" pdf
... sites is located in the Lehstenbach catchment in the Fichtelgebirge (Northeast Bavaria/Germany; latitude 50° 9’N, longitude 11 ° 52’E) which comprises an area of ca km with altitudinal variation ... table II Stand density and stand basal area were determined for all 803 trees within the study area (2.5 ha; Gerstberger, unpublished) Leaf biomass (LW), total leaf surface (LS) and sapwood area ... sapflow on environmental variables Vapor pressure deficit (D) was calculated using the MAGNUS formula [7] with constants from Smithsonian Meteorological Tables [50] Standard meteorological data...
- 15
- 278
- 0
Báo cáo y học: "First-dose analgesic effect of the cyclo-oxygenase-2 selective inhibitor lumiracoxib in osteoarthritis of the knee: a randomized, double-blind, placebo-controlled comparison with celecoxib [NCT00267215]" doc
... such as bleeds and perforations [7] COX-2 selective inhibitors have demonstrated analgesic and anti-inflammatory efficacies comparable with those of traditional NSAIDs in patients with arthritis, ... on apparent plasma clearance [18] In addition, lumiracoxib has demonstrated sustained higher synovial fluid concentrations compared with plasma concentrations in patients with rheumatoid arthritis ... using analysis of covariance (ANCOVA) The statistical fixed-effects model considered treatment and centre as main effects, whereas baseline actual pain was used as a covariate Data from small centres...
- 9
- 423
- 0
Báo cáo y học: "proximal interphalangeal joints in rheumatoid arthritis: a comparison with magnetic resonance imaging, conventional radiography and clinical examination" pdf
... Østergaard M: Ultrasonography of the metatarsophalangeal joints in rheumatoid arthritis: comparison with magnetic resonance imaging, conventional radiography, and clinical examination Arthritis ... proximal interphalangeal joint: early RA Arrows indicate an area with synovitis Ultrasonography in (a) the longitudinal plane from the dorsal aspect shows signs of synovitis (grade 4) Axial T1-weighted ... for assessment of synovitis in the metacarpophalangeal joints of patients with rheumatoid arthritis: a comparison with dynamic magnetic resonance imaging Arthritis Rheum 2001, 44:2018-2023 Available...
- 11
- 379
- 0
Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx
... the radiographically non-erosive areas, the analysis was repeated after excluding all quadrants with radiographic erosions (16 quadrants) In this analysis MRI exhibited a sensitivity, specificity ... coronal and (f) axial planes reveal the same erosions in the 3rd and 5th metacarpal heads as marked on the CT images US at the ulnar aspect of the 5th metacarpal head, in (g) longitudinal and ... (EN) with experience from previous studies in evaluating RA radiographs Imaging evaluation All imaging modalities were evaluated with investigators blinded to clinical and other imaging data Each...
- 9
- 376
- 0
báo cáo khoa học: "Genetic properties of North African Drosophila melanogaster and comparison with European and Afrotropical populations" pps
... 1979 a Comparison of the NT IEMO AURENT T O QUIGN EGAS-PE I karyotypes of four Cercopithecoïdae : Papio papio, P.anubis, Macaca mulatta and M fascicularis Cytogenet Cell Genet., 23, 77-83 DuTRaLAUx ... confirme la notion de la grande stabilité du caryotype des Papioninae Un autre argument en faveur de cette stabilité est la rareté des remaniements intraspécifiques Ainsi, sur plus de 170 animaux dont ... Papio hamadryas Ann Génét., 19, 269-272 HIARELLI C B., 1962 Comparative morphometric analysis of primate chromosomes II The chromosomes of genera Macaca, Papio, Theropithecus and Cercocebus Caryologia,...
- 7
- 266
- 0
báo cáo khoa học: "Genetic properties of North African Drosophila melanogaster and comparison with European and Afrotropical populations" pdf
... (North America, Europe, equatorial Africa, East Asia and Australia) which harbour populations with very different histories (DAVID and T 1981) As argued for , SACAS ET example by DAVID and BOCQU ... discriminative trait is wing length while the most stable within a geographic area is the number of abdominal chaetae Table also allows a comparison of the three geographic groups For the various traits, ... of allopatric variations in D melanogaster, it now appears necessary to extend the analysis to populations not yet studied and also to increase the number of genetically variable traits which are...
- 15
- 303
- 0
Báo cáo khoa hoc:" Retroperitoneoscopic radical nephrectomy with a small incision for renal cell carcinoma: Comparison with the conventional method" docx
... in cases In the latter, pathological tumor stage was T 1a in 25 cases, T1b in cases and larger T2 in cases Histological data and nuclear grade was available In the A method, 84.3% had clear cell ... of a combined small skin incision Page of 13 Tanaka M, Tokuda N, Koga H, Yokomizo A, Sakamoto N, Naito S: Hand assisted laparoscopic radical nephrectomy for renal carcinoma using a new abdominal ... T1N0M0 renal cell carcinoma That’s because we thought that laparoscopic approach caused peritoneal adhesion more than retroperitoneoscopic approach In T2-T3aN0M0 renal cell carcinoma as well as in...
- 5
- 248
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25