... Casp9 Figure caspase and activation in N-ras-/ -and H-ras-/-/N-ras-/- fibroblasts Increased Increased caspase and activation in N-ras-/ -and H-ras-/-/N-ras-/- fibroblasts Caspase and activities were ... processes of cellular growth and proliferation, such as RNA binding/ metabolism/processing and ribosomal protein biosynthesis (Table 2; Figure 3b, blocks and 3) On the other hand, analysis of the population ... signal transduction, cell development and differentiation and cell adhesion (Figure 4) In particular, the categories of primary cell metabolism and cell development and differentiation showed the highest...
... CCACCTAAACCATAAGTCCTATTGG3’ and 5’ CCTATTACTAAAATGTAGGTTCAGTAAAGGTAG3’) All genomic andcDNA sequences were cloned and confirmed by DNA sequencing The cDNAand genomic sequences of Glyma04g35130 from both lines, CS and ... and UV light, and in transpiration and leaf temperature regulation [2-4] The genetic control of non-glandular trichome initiation and development has been studied extensively in Arabidopsis and ... blot of Clark standard (CS) and Clark glabrous (CG) genomic DNA The CS and CG genomic DNA were digested with BamHI, HindIII, EcoRI, DraI, BglII, and EcoRV The RFLPs between CS and CG digests are...
... strand, and GA(23–24) (Fig 2C) and AT(24–25) (Fig 2D) steps of the PNA strand, flanking the A24 C7 mismatch in PDwt (Scheme 1), and the corresponding AT(6–7) & TC(7–8) steps of the DNA strand ... )1.3 A, ˚ and )10.7°, respectively, for PDwt, and 3.3 A ˚ )4.0 A and )10.6°, respectively, for PDmut Average ˚ widths of minor and major grooves are around 9.5 A ˚ in both PDwt and PDmut and 25 ... cis) (A and B) and (a,e) (gauche+, trans) (C and D) conformations O6¢(G) .N2(G) hydrogen bond (C and D) is shown in dotted line (see also Fig 10 and text) Hydrogens at C2¢, C3¢, C5¢ and C8¢...
... wild-type and His-tagged PSI-G by high-resolution SDS ⁄ PAGE (C) Immunodetection of His and Strep tags in PSI-G constructs and transformed plants were treated separately with thermolysin and trypsin ... homology between PSI-G and PSI-K, from which PSI-G probably arose by gene duplication [4], would suggest a ‘horseshoe’-like topology, with the loop facing the stroma and the N- and C-termini in the ... Synechocystis 6803 [14] and Chlamydomonas reinhardtii [15] and to determine the location of PsbH in photosystem II (PSII) of C reinhardtii [16] We now report the expression of His- and Strep-tagged...
... sarcosine or sarcosine analogues (monomeric and tetrameric sarcosine oxidases and sarcosine and dimethylglycine dehydrogenases), on D-amino acids (DAAO and DASPO) and on pipecolic acid (PIPOX) (see Table ... methionine and six histidine residues (Fig 1) The correct insertion of the GO gene was checked by digestion with the restriction enzymes NdeI and BamHI/ScaI and by a PCR reaction, using the XbaI [6] and ... (R302, see Fig 2C) On the other hand, and according to the sequence comparison, M261 in GO appears to be located at the position occupied by Y238 and H269 in DAAO and MSOX, respectively This second...
... elongation reactions of fatty acids and the combinatorial complexity in the composition of different phospholipids, triglycerides, and other lipid species Understanding this complex network is of ... membrane constituents and products may still be produced by such an L-form mutant, and investigated whether hitherto unknown bypass mechanisms exist This should prove useful for understanding such morphogenetic ... balanced with respect to production and consumption In contrast, source and sink compounds, called external metabolites, are considered to have buffered concentrations and need not to be balanced If...
... analyses JLD, AA and JG performed electron microscopy studies GF contributed to PBMC infection studies GF and SB coordinated the research BP and SB wrote the manuscript All authors read and approved ... independent experiments Error bars correspond to the standard error of the mean B Rabbit and bovine cells were infected with the T1-TK::LacZ (m.o.i of 0.1 and 1) Twenty-four hours p.i., they were fixed ... UI12A, Magnifications, A: 35000; B: 15000; C and D: 90000 In this study, we investigated the interactions between bovine cells (cell lines and PBMC) and MYXV wild type (T1) strain or vaccinal (SG33)...
... analyses JLD, AA and JG performed electron microscopy studies GF contributed to PBMC infection studies GF and SB coordinated the research BP and SB wrote the manuscript All authors read and approved ... independent experiments Error bars correspond to the standard error of the mean B Rabbit and bovine cells were infected with the T1-TK::LacZ (m.o.i of 0.1 and 1) Twenty-four hours p.i., they were fixed ... UI12A, Magnifications, A: 35000; B: 15000; C and D: 90000 In this study, we investigated the interactions between bovine cells (cell lines and PBMC) and MYXV wild type (T1) strain or vaccinal (SG33)...
... AA and ER participated in the RNA isolation, microarray experiments and statistical analysis of data, quantitative real-time PCR; LC and RB conceived the study and participated in its design and ... -80°C Ascorbate and glutathione were extracted and assayed following the method developed by Queval and Noctor [119] ATP and ADP were assayed as previously described [120] Amino acids and sugars were ... material and method session Symbols and error bars show means ± SD (D) Western-blots were used to detect oxidized thylakoid proteins extracted from wild type and npq1lut2 membranes WT and npq1lut2...
... crucial importance in both agriculture and horticulture When fruits and seeds undergo abscission, they provide an efficient and effective means of dispersal and propagation so that plants are maintained ... provide valuable insights into elucidating and understanding the biochemical and structural basis of the abscission process [26] Such mutants have been described and characterized in a wide range of ... mutant allele and two lines carry the wild type (Def) allele Results Seed abscission in wild type and def mutant pea Phenotypic differences between seeds and pods of JI 116 (wild type Def) and JI 3020...
... interpretation and in the writing HOK and HSK performed the analysis of the data and drafted the manuscript JCY and ECS participated in the design of the study and performed the statistical analysis and ... (Tables andand Figure 1) TGF-a binds to the EGF receptor with a high affinity [21] and is indispensable for the proper development of many tissues and organs, wound healing, bone resorption, and ... aging (Tables andand Figure 1) The CD40/CD40L system belongs to the tumor necrosis factor superfamily and is a key pathway that links inflammation and atherothrombosis [17] CD40 and CD40L are...
... regression plots, the Km and kcat values determined for the spectroscopic assay were 1.04 ± 0.10 mm and 5.78 ± 0.58 s)1, and for the LC-MS assay were 1.05 ± 0.03 mm and 5.73 ± 0.16 s)1 (Table ... Coomassie blue showed single bands for the wild-type and mutants D392N and E315M, migrating with an Mr of 63 000 (Fig 4A) In the case of the E315Q mutant, an additional faint band was also seen at an ... trimer and the pentamer compared to the dimer were 34% and 30% for the wildtype, but 66% and 47% for the D392N mutant (Fig 5B) A Oligosaccharide synthesis by chitinase A Protein expression and hydrolytic...
... annealing and elongation time of and an annealing temperature of 55 °C We used the following pairs of flanking and mutagenic primers, where Eco91I and XagI restriction sites are underlined and the ... absence of ligand (d), in the presence of 20 mM arsenate (s), and in the presence of 20 mM arsenate and mM GL (.); 31P shift for the H334G mutant (,), recorded in the absence of arsenate and at only ... from both the main chain amide and the side chain of Ser Hydrogen bonds between PLP phosphate and the side chains of nearby Lys residues and bound phosphate ligand appear to be stronger in maltodextrin...
... amidotransferases can utilize NH2OH and NH2NH2 in place of NH3 [4244] Both NH2NH2 and NH2OH (and its derivatives NH2OCH3 and CH3NHOH) Exogenous NH3 and its analogues Exogenous NH3, NH2OH, and NH2NH2 all served ... tunnel and ensures efcient coupling of the Gln hydrolysis and amination reactions In the present study, we use bulky analogues of exogenous NH3 (i.e NH2OH and NH2NH2) and nascent NH3 (i.e NH2OH and ... 0.50, 1.0, 5.0, and 10.0 mM), Gln-OH (1.0, 3.0, 5.0, 7.0, and 10 mM), or GlnNH2 (3.0, 7.0, 10.0, 15.0, and 20.0 mM) CTPS concentrations ranged between and 56 lgặmL)1 for wild-type and 554 lgặmL)1...
... phosphate buffer at pH 5.8 and 8.0 Materials and methods Results and discussion Protein production and purification The purification of wild-type Cel7A enzyme and the E217Q and E223S/A224H/L225V/T226A/D262G ... wild-type Cel7A and pH mutant E223S/A224H/L225V/T226A/D262G at pH 5.8 and pH 8.0 and 25 °C Spectra of the wild-type Cel7A at pH 5.8 (d) and pH 8.0 (s), and the pH mutant at pH 5.8 (j) and pH 8.0 (h) ... wild-type Cel7A in 50 mM potassium phosphate pH 8.0 (A and B) and catalytically inactive E217Q mutant in 50 mM NaAc pH 5.0 (C and D) (A) and (C) The relative intrinsic fluorescence (Int; 1.0 at...
... interpretation and in the writing HOK and HSK performed the analysis of the data and drafted the manuscript JCY and ECS participated in the design of the study and performed the statistical analysis and ... (Tables andand Figure 1) TGF-a binds to the EGF receptor with a high affinity [21] and is indispensable for the proper development of many tissues and organs, wound healing, bone resorption, and ... aging (Tables andand Figure 1) The CD40/CD40L system belongs to the tumor necrosis factor superfamily and is a key pathway that links inflammation and atherothrombosis [17] CD40 and CD40L are...
... interpretation and in the writing HOK and HSK performed the analysis of the data and drafted the manuscript JCY and ECS participated in the design of the study and performed the statistical analysis and ... (Tables andand Figure 1) TGF-a binds to the EGF receptor with a high affinity [21] and is indispensable for the proper development of many tissues and organs, wound healing, bone resorption, and ... aging (Tables andand Figure 1) The CD40/CD40L system belongs to the tumor necrosis factor superfamily and is a key pathway that links inflammation and atherothrombosis [17] CD40 and CD40L are...
... deep sequencing, and we thus chose to use tiling arrays as our primary method to map the transcriptome across multiple developmental stages, and deep sequencing to validate the tiling data and ... cDNA was then produced using SuperScript™ Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA) and purified using a QIAGEN PCR Purification Kit Sequence data for the resulting cDNA ... Wolfgang Huber for critical comments and help with the data analysis, Sanger core sequencing for their sequencing efforts and the Fraser lab for comments and suggestions The authors declare that...
... Complementary DNA and RNA probes have been used to detect RNA and mRNA of the CDV genome with improved specificity and sensitivity[6,7] Primers P1 and P4 (specific for CDV and conserved among ... wild-type viruses and belonged to a genotype that is obviously different from the CDV vaccine strain After the application of the first-round PCR, primers P2 and P4, and P3, P4, P5 and P6 together, ... of the multiplex RT-nPCR A fragment of 247 and 177 bp was amplified from CDV wild-type strain and the vaccine strain, respectively Two bands of 247 and 177 bp were detected simultaneously from...
... identification and characterization, protein modeling and drafted the manuscript MAI performed genome sequencing JH developed and isolated CDV-R and WT viruses SI conceived, directed and coordinated ... heterodimerization and MT activity (Figure 10A and 10B, in red and yellow) [53,56] The basic H122 residue flanks two neutral residues, 120N and 121N, that affect important polar interactions between D1 and ... complex and RNA processing machinery may inform current therapeutic development strategies and yield further insight into CDV-resistance and attenuation Methods Viral DNA extraction, amplification and...