is a filbert a tree nut

Tài liệu Where There Is No Psychiatrist A Mental Health Care Manual ppt

Tài liệu Where There Is No Psychiatrist A Mental Health Care Manual ppt

Ngày tải lên : 15/02/2014, 02:20
... learning And to my teachers, especially Tony Hope Alwyn Lishman Anthony Mann Ashit Sheth Mohan Isaac for instilling the joy of teaching A mental health care manual by Vikram Patel Where There Is ... this manual The manual is divided into four parts. It is important that readers familiarise themselves with Part I before reading the other parts. This is because much of the rest of the manual ... ‘mental retardation’ is being dropped by many health workers. This is because it is often used in a discriminatory way. Instead, the term ‘learning disability’ is preferred. In this manual, we...
  • 290
  • 1.3K
  • 0
Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

Ngày tải lên : 16/02/2014, 03:20
... U.S. also note that credentials are not always transferable across programs and geographies, and many pathways to credentials are expensive. These pathways are not always available in all locations ... certificates, is the American National Standards Institute. ANSI provides a process for evaluating requirements within a standard. The standard associated with certifications is an American National ... credentials awarded is that a great deal of credit-worthy education and training is taking place, but it is often disconnected from educational pathways that could lead to postsecondary certificates...
  • 46
  • 477
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20
... PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG Reverse ... GCTCACTGCCTA AGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2) SJS175 CTTTATTAGCTACA AAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2) SJS259 CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG ... CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH) SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2) SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG T7Forward (nt 1491–1508 PAI-2) PAI-2 mRNA decay...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: "A Hybrid Convolution Tree Kernel for Semantic Role Labeling" pptx

Tài liệu Báo cáo khoa học: "A Hybrid Convolution Tree Kernel for Semantic Role Labeling" pptx

Ngày tải lên : 20/02/2014, 12:20
... Krugler, Wayne Ward, James H. Martin, and Daniel Juraf- sky. 200 5a. Support vector learning for semantic argument classification. Machine Learning Journal. Sameer Pradhan, Wayne Ward, Kadri Hacioglu, James Martin, ... (Palmer et al., 2005). The PropBank defines 6 main arguments, Arg0 is the Agent, Arg1 is Patient, etc. ArgM- may indicate adjunct arguments, such as Locative, Temporal. Many researchers (Gildea ... EMNLP-2004. Martha Palmer, Dan Gildea, and Paul Kingsbury. 2005. The proposition bank: An annotated corpus of se- mantic roles. Computational Linguistics, 31(1). Sameer Pradhan, Kadri Hacioglu, Valeri...
  • 8
  • 390
  • 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Ngày tải lên : 21/02/2014, 00:20
... not mark any as poor or inappropriate. Another structural analysis, obtained by the VERIFY 3 D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... r a Þ where r n and r u are the experimentally determined numerical values of the ratio a/ b, and r a is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and ... When removing NaCl by prolonged dialysis, this protease is activated and cleaves PsbQ at low salt concentrations. We circumvented the drawbacks of the 1- M NaCl wash by taking advantage of the Cu 2+ effect....
  • 12
  • 550
  • 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Ngày tải lên : 06/03/2014, 09:22
... by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar- boxylase ... Ulbrich A, Matsuda A, Reddy VA, Orth A, Chanda SK, Batalov S & Joazeiro CA (2008) Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates ... Y, Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al. (2006) Rac1 and a GTPase- activating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors. J...
  • 12
  • 432
  • 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Ngày tải lên : 07/03/2014, 16:20
... 5¢-CCGTCGACATTAATTTGAGAAATTATAT TGCGTCGCccg ccggcCgcCacgGAGGGTGAC-3¢ (again the SalI r ecognition site is i n bold, the location of the Adf-1 element is underlined, and nucleotides in lowercase have ... Functional analysis of the GAGA/Adf-1 cassette in heterologous promoters. Hybrid promoters indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties. (A) The basal promoter activity ... using the primers pADm1 (forward; 5¢-AGCA GTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢ -A TCC GTCGACATGCTTTTTAACTGTT CG-3¢). After d igestion with SalI (which recognizes the sequence...
  • 11
  • 532
  • 0
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

Ngày tải lên : 08/03/2014, 10:20
... 35–39. 14. Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe ,A. ,Iriguchi,M.,Ishikawa ,A. ,Kawashima,K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , ... Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M. & Tabata, S. (2001) Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain ... dimers are detectable. Keywords: phycobilisome; chlorosis; NblA; cyanobacteria; analytical ultracentrifugation. Cyanobacteria are a widespread group of photosynthetic prokaryotes performing a plant-type...
  • 8
  • 308
  • 0
Cách sử dụng (Something) is down to (a number of something) pdf

Cách sử dụng (Something) is down to (a number of something) pdf

Ngày tải lên : 10/03/2014, 11:20
... Maria - Hiện giờ chỉ còn tôi, Claire và Maria. Lưu ý rằng khi sử dụng “down to” thường kèm “now”, ở đâu đó trong câu. Với bài viết Daily English Speaking Lesson này, sẽ cho chúng ta ... half a bag of rice” = “chúng tôi giờ chỉ còn n a bao gạo”. Thông thường bạn nói về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể liệt kê như: Now it’s down to just me, Claire, and ... c a bạn đều bị sa thải. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn nói chuyện với bạn c a mình về tình huống này. “We’re down to only 3 people now” (something) is down to (a...
  • 6
  • 702
  • 2
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Ngày tải lên : 16/03/2014, 06:20
... (San Diego, CA, USA). Secondary anti-mouse and anti- (rabbit HRP) IgG were from Amersham (Piscataway, NJ, USA) and the secondary anti-(goat HRP) IgG was from Santa Cruz Biotechnology (Santa Cruz, ... compilation ª 2008 FEBS 3487 presence of a general protease inhibitor cocktail (Roche, Laval, Canada) and 200 lm sodium orthovanadate (a phos- phatase inhibitor; Sigma-Aldrich, Oakville, Canada) and centrifuged ... Ottawa Hospital, Canada 2 Laboratory of Biochemical Neuroendocrinology, Clinical Research Institute of Montreal, Canada Proprotein convertase subtilisn ⁄ kexin 9 (PCSK9) is a member of the mammalian...
  • 14
  • 454
  • 0
Báo cáo khoa học: "A non-contiguous Tree Sequence Alignment-based Model for Statistical Machine Translation" pptx

Báo cáo khoa học: "A non-contiguous Tree Sequence Alignment-based Model for Statistical Machine Translation" pptx

Ngày tải lên : 17/03/2014, 01:20
... statistical machine translation with syn- tactified target language phrases. EMNLP-06. 44-52. Franz J. Och and Hermann Ney. 2004. The alignment template approach to statistical machine translation. ... it is hard for phrase-based models to learn global reorderings and to deal with non- contiguous phrases. To address this issue, many syntax-based approaches (Yamada and Knight, 2001; Eisner, ... Li, Aiti Aw, Sheng Li. 2008b. Grammar Comparison Study for Transla- tional Equivalence Modeling and Statistical Machine Translation. COLING-08. 1097-1104. Ying Zhang. Stephan Vogel. Alex Waibel....
  • 9
  • 281
  • 0
Báo cáo khoa học: "A Pylonic Decision-Tree Language Model with Optimal Question Selection" potx

Báo cáo khoa học: "A Pylonic Decision-Tree Language Model with Optimal Question Selection" potx

Ngày tải lên : 17/03/2014, 07:20
... growing, data is fragmented among the leaves, and this issue becomes unavoidable. To deal with this problem, we choose the atomic partition P so that each atom gets a history count above a threshold. ... Estimating the Language Model at Each Leaf Once an equivalence classification of all histo- ries is constructed, additional training data is used to estimate the conditional probabilities required ... such a hierarchy by taking a cut through the tree to obtain a set of subtrees. The reason for keeping a hierarchy instead of a fixed partition of the vocabulary is to be able to dynamically adjust...
  • 4
  • 283
  • 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Ngày tải lên : 23/03/2014, 07:20
... FXI-deficient plasma as sub- strate (Hemoliance, Salt Lake City, UT). FXI antigen was measured by an ELISA based on a goat anti-human FXI affinity purified IgG as capture antibody and a goat anti- human FXI ... Fujikawa K, Legaz ME, Kato H & Davie EW (1974) The mechanism of activation of bovine factor IX (Christmas factor) by bovine factor XIa (activated plasma thromboplastin antecedent). Biochemistry ... proteases that can activate FXI, i.e. activated factor XII (FXIIa), FXIa, and thrombin, the main physiologic activator is actually thrombin formed on the surface of activated platelets [6–8]. Cleavage...
  • 11
  • 563
  • 0
Báo cáo khóa học: Emerin binding to Btf, a death-promoting transcriptional repressor, is disrupted by a missense mutation that causes Emery–Dreifuss muscular dystrophy pdf

Báo cáo khóa học: Emerin binding to Btf, a death-promoting transcriptional repressor, is disrupted by a missense mutation that causes Emery–Dreifuss muscular dystrophy pdf

Ngày tải lên : 23/03/2014, 12:20
... 34 AAAA S54F 54S 54 F 70 70DADMY 70 AAAMA 76 76LPKKEDAL 76 APAKADAA 112 112GPSRAVRGSVT 112 AASRAVAAAVA 133 133Q 133H 141 141SSSEEECKDR 141 AASAEECKAA 164 164ITHYRPV 164 AAHARPA 179 179LS 179 AA 183 ... 104TYGEPES 104 AYGEAEA 122 122TS 122 AA 145 145EE 145AA 151 151ER 151 AA 161 161YQS 161 AAA 175 175SSL 175 AAA 192 192SSSSS 192 ASAAA 198 198SSWLTR 198 AAAAA 206 206IRPE 206 AAPA 24 24GPVV 24 AAAA 34 34YEKK ... TCC CTA GAA GGG GTT GCC TTC TTC DTM H-emerin BamHI GGG GAT CCC TGG CCC CAG AGC GG btf 377–5¢ AAC ATA TGG ATC AGG AAG CTC TAG ATT AC 521–5¢ AAC ATA TGG CAC GAG AAA AGT CTA CCT TC 574–3¢ TTG GAT CCT...
  • 11
  • 377
  • 0
Báo cáo khoa học: "Improving Grammaticality in Statistical Sentence Generation: Introducing a Dependency Spanning Tree Algorithm with an Argument Satisfaction Model" pptx

Báo cáo khoa học: "Improving Grammaticality in Statistical Sentence Generation: Introducing a Dependency Spanning Tree Algorithm with an Argument Satisfaction Model" pptx

Ngày tải lên : 24/03/2014, 03:20
... Related Work 6.1 Statistical Surface Realisers The work in this paper is similar to research in statistical surface realisation (for example, Langk- ilde and Knight (1998); Bangalore and Rambow (2000); ... translation, para- phrase generation, and summarisation systems (Soricut and Marcu, 2005). Our research in sum- marisation utilises the statistical generation algo- rithms described in this paper ... statistical machine translation has been applied to paraphrase generation (Bannard and Callison-Burch, 2005) and multi-sentence align- ment in summarisation (Daum ´ e III and Marcu, 2004). These approaches...
  • 9
  • 305
  • 0

Xem thêm