ironies in the shadows literally untold profits and a key source of development
Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt
Ngày tải lên :
23/03/2014, 23:20
... origin of the data We did not separately estimate uncertainty in commercial input data and industrial input data Tables A- 27 and A- 28 show our estimates of the range of uncertainty in commercial/industrial ... of their rated capacity) Most analyses of imaging energy and paper use begin with the total amount of paper used and then allocate this total based on professional judgment and anecdotal data ... management enabled rate (SPM) of displays Stock of inkjet printers and faxes Active power of servers and faxes Low power requirement of mainframes and laser printers Usage of inkjet printers and...
- 50
- 454
- 0
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx
Ngày tải lên :
11/08/2014, 11:21
... gCggAATTCATggAATCCAATTCgTTTTTC 3’ EcoRI ATHB1 and ATHB1WCT cloning ATHB1R 5’ gCgggATCCTAAggCCATCCCCAgAAAg 3’ BamH1 ATHB1 cloning ATHB1WCTR 5’ gCggTCgACTACTCTTgTTTgCCCTgAAgC 3’ Sal1 ATHB1WCT cloning ... versions and did the yeast transactivation assays JC together with ALA and JR analyzed the phenotype of the transgenic plants RLC conceived this study, participated in the design and coordination and ... Finally, three sequences from sunflower and Medicago truncatula (i.e., MTHB1, HAHB1 and HAHB11) were manually added The final dataset is in Additional file Data alignments and phylogenetic analysis...
- 19
- 355
- 0
Báo cáo y học: "Percutaneous tracheostomy in patients with severe liver disease and a high incidence of refractory coagulopathy: a prospective trial" doc
Ngày tải lên :
13/08/2014, 08:20
... were involved with the clinical aspects of the study GA and WB were concerned with analysis and interpretation of data All authors were involved with the clinical aspects of the study All authors ... Transfusion of red packed cells in which another source of bleeding was evident, and in the absence of any stomal or intratracheal haemorrhage, was not deemed to be a complication of the procedure Statistical ... in- hospital mortality in patients with cirrhosis admitted to a medical ICU The average SOFA score of the patients in this study was 13, and a third of the patients had chronic liver disease as their...
- 7
- 315
- 0
a history of light and colour measurement, science in the shadows - johnston
Ngày tải lên :
05/06/2014, 11:28
... national and industrial laboratories in Britain, America and Germany were crucial in stabilizing practices and raising confidence in them Through the inter-war period, committees and international ... Reichsanstalt 5.3 The National Physical Laboratory 5.4 The National Bureau of Standards 5.5 Colour at the national laboratories 5.6 Tracing careers 5.7 Weighing up the national laboratories 5.8 Industrial ... verification of illumination standards; and industry, by defining norms of efficiency and standards for quality control This is a case of the pursuit of utilitarian advantages leading to fundamental research:...
- 292
- 439
- 0
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
Ngày tải lên :
31/10/2012, 14:59
... Publication bias may be always a possible limitation of combining data from various sources as in a meta-analysis The idea of adjusting the results of meta-analyses for publication bias and imputing "fictional" ... bind damaged DNA, and because RPA and XPA directly interact in the absence of DNA, the RPA-XPA complex has been implicated as a key component in the earliest stage of damage recognition [41] There ... Tanaka K, Miura N, Satokata I, et al Analysis of a human DNA excision repair gene involved in group A xeroderma pigmentosum and containing a zinc-finger domain Nature 1990; 348: 73-6 65 Sarasin...
- 13
- 711
- 0
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System
Ngày tải lên :
05/09/2013, 09:38
... reed The phosphorus accumulated in this period seemed to be utilized in the next year Based on these findings, a management method adequate to obtain the biomass of the giant reed and maintain the ... Na2H32PO4 The amount of phosphorus accumulated was continuously measured by using a beta ray survey meter (ALOKA TGS-146) placed on the leaf The amount of phosphorus in the leaves was calculated based ... on the count of the beta ray, capture efficiency, device efficiency, and a specific value of the reagent The phosphorus accumulation was assumed to be uniform in all the leaves, and the total amount...
- 12
- 1K
- 0
Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas
Ngày tải lên :
05/09/2013, 10:17
... periphyton and sessile animals We define the fatty acids with > 5% content as dominant fatty acids and Fig shows the dominant fatty acids in the leaves and stems of Z japonica in each sampling site The ... USA); and kinds of long-chain fatty acids (LCFAs) These standards were used to obtain 56 kinds of fatty acids Therefore, the contents of each fatty acid were calculated based on the quantity of ... lipid, the content ratios of all the fatty acids, and the ratio of each fatty acid RESULTS AND DISCUSSION Characteristics of carbon stable isotope in Z japonica The mean δ13C of Z japonica was -12.4...
- 9
- 614
- 2
Picture of the victorian society in the two novels oliver twist and vanity fair = bức tranh xã hội anh thời kì victoria qua hai tác phẩm ôlivơ tuyxt và hội chợ phù hoa
Ngày tải lên :
19/12/2013, 14:05
... etc of the upper class: “there is a great 41 quality of eating and drinking, making love and jilting, laughing and the contrary, mocking, cheating, fighting, dancing and fiddling” (Vanity Fair) ... In “Vanity Fair”, readers can witness a splendid London where the rich and the powerful are singing, dancing, eating, drinking and even cheating, betraying and swearing in the through-night and ... husbands, children, wives, blood, souls and bodies In fact, the life in “Vanity Fair” was turning round and round with laughing and crying, singing and dancing, eating and nosily drinking, etc of...
- 67
- 998
- 4
Tài liệu Practical considerations in the European market for building and future-proofing robust, flexible FTTN infrastructures ppt
Ngày tải lên :
24/01/2014, 11:20
... several directions, there are advantages in having patch cabinets, at least in certain locations Again, it’s incumbent upon the planner to decide where advantage is gained from connectorization in ... (connect) cables Again, many service providers have their own rules and standards In a patch, the cable is brought above ground into a patch cabinet The alternative is to splice it in an underground ... provide coverage to a nominal circular area of between four and eight cabinets per main cable The reach from the CO is approximately 4-5 km, dictated by the cable gauge Two or more main cables might...
- 4
- 512
- 0
Tài liệu Báo cáo Y học: Induction of (2¢)5¢)oligoadenylate synthetase in the marine sponges Suberites domuncula and Geodia cydonium by the bacterial endotoxin lipopolysaccharide docx
Ngày tải lên :
21/02/2014, 15:20
... cydonium and in mammals (mouse) and chicken: The (2–5 )A synthetase signature-1 [14], is found between amino acid 195 and amino acid 206 and signature-2 between amino acid 258 and amino acid 268; the ... suggested that the animals kept in the aquarium are lacking a factor that causes either the expression of the gene encoding the (2–5 )A synthetase or the activation of the enzyme One potential factor ... synthesized as described under Materials and methods Lane a: S domuncula (aquarium animal); lane b: S domuncula (sea animal); lane c: G cydonium (sea animal) Lane a and b: mg of total protein per assay,...
- 11
- 578
- 0
Tài liệu In the Shadows of a Fallen Wall docx
Ngày tải lên :
22/02/2014, 06:20
... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and ... strategy that involved indoctrinating guards into state ideology and, just as important, placing them in groups of two and three to keep watch on one another These tactics — indoctrination and ... Platz had, phoenix-like, arisen into a stunning array of architecture housing Sony, DaimlerChrysler, a Grand Hyatt Hotel, and an IMA X theater, among others For my family and me — and all the other...
- 208
- 481
- 0
THE REPRODUCTION OF LABOR-POWER IN THE GLOBAL ECONOMY, MARXIST THEORY AND THE UNFINISHED FEMINIST REVOLUTION ppt
Ngày tải lên :
05/03/2014, 17:20
... of unfree labor, and the increasing criminalization of the working class, through mass incarceeration (recalling the 17th century Grand Confinement), and the formation of an ex-lege proletariat ... recognition of the importance of reproduction and women's domestic labor for capital accumulation led to a rethinking of Marx's categories, and a new understanding of the history and fundamentals of capitalist ... danger today, is that beside devouring the earth, capitalism unleashes more wars of the kind the US has launched in Afghanistan and Iraq, sparked off by the corporate need to gain access to mineral...
- 20
- 593
- 0
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
Ngày tải lên :
06/03/2014, 00:20
... NADP+ can arise If we assume the use of a commercial NADP+ containing 0.3% NAD+, as in the case of the Roche sample used in this study, then in a steady-state assay, as in the rapid-reaction ... identity of the contaminant Comparison with the spectrum of an authentic NAD+ sample revealed total similarity of the fragmentation pattern The negative portion of the spectrum displayed a fragment at ... study, the contaminating NAD+ will be used rst There will not be simple proportionality because the mm NAD+ in a standard assay is well above Km and the 0.3% NAD+ contamination in mm NADP+ is far...
- 9
- 526
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
Ngày tải lên :
07/03/2014, 15:20
... that interfacial protein–protein interactions between the hinge region of ISP and the extramembranous cd2 helix of cytochrome b are important for maintaining the structure of the hinge region and, ... because the addition of an equal amount of decylubiquinone to decylubiquinol at the beginning of the assay had no effect on the kinetics (data not shown) It is more probable that the mutant was ... inhibited the activity in samples from the patient This was in agreement with the data obtained in this study, using the mutant yeast enzyme It has been reported that a mutation in the hinge region of...
- 7
- 498
- 0
Volatile Organic Compounds in the Nation’s Ground Water and Drinking-Water Supply Wells pdf
Ngày tải lên :
14/03/2014, 19:20
... California the Central Valley aquifer system and the California Coastal basin aquifers in and near Los Angeles and in the Basin and Range basin-fill aquifers in Nevada The relatively large detection ... Reporting at the Principal-Aquifer Scale Help Link National and Local-Scale Findings Analysis and reporting of NAWQA’s first decade of sampling have focused on national and Study-Unit (local-scale) assessments ... this type of contamination can spread over a large area Contamination also can originate over large areas from sources such as leaking water and sewer lines, stormwater runoff, and atmos- pheric...
- 112
- 573
- 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
Ngày tải lên :
16/03/2014, 04:20
... catalytic cysteine) and the C-terminal domain The third domain, referred to as the loop domain, protrudes out of the N-terminal domain The loop domain covers the catalytic site and provides the ... and Leu148 (the innermost peptide bond, near the catalytic site) The atoms shaping the binding environment of the terminal sulfur atom of CoA are listed in Table and shown in Fig Apart from the ... determined and analysed: the structure of a complex of CoA with the C8 9A variant and a complex of CoA bound in the active site with an oxidized Cys89 The latter structure was obtained from a soaking...
- 13
- 472
- 0
Coexisting Bronchogenic Carcinoma and Pulmonary Tuberculosis in the Same Lobe: Radiologic Findings and Clinical Significance doc
Ngày tải lên :
22/03/2014, 18:20
... proliferation and metaplasia involving the terminal air-space (13) Others, though, are of the opinion that the scar represents a desmoplastic reaction and is the result, rather than the cause, of ... plays an important A causative role in the development of lung cancer (9, 10); (B) As the reactivation of TB by carcinoma It has also been reported that the development of lung cancer in areas ... scans and the stage of the cancer was also determined If the short diameter of a lymph node was greater than cm, this was taken to indicate metastatic lymphadenopathy Twenty-one of the 51 patients...
- 7
- 518
- 1
Báo cáo khoa học: Paralog of the formylglycine-generating enzyme – retention in the endoplasmic reticulum by canonical and noncanonical signals pptx
Ngày tải lên :
23/03/2014, 07:20
... from platypus, the snail Biomphalaria glabrata, the planarian Schmidtea mediterranea, and the sea anemone Nematostella vectensis However, human pFGE and also pFGE from 20 further mammalian species ... L Gande et al of a fatal nature that is characterized by the synthesis of catalytically inactive sulfatases lacking FGly [12,13,16,17] All multiple sulfatase deficiency patients analyzed so far ... not affect binding of DDEL-containing ligands in vitro and in vivo, which suggests that different retrieval signals make different contacts in the binding pocket The variability in the retrieval...
- 13
- 490
- 0
Bringing in the Excluded? Aesthetic labour, skills and training in the ‘new’ economy doc
Ngày tải lên :
23/03/2014, 13:20
... fabrication to intellectualism Bell uses the game metaphor to describe a ‘game against nature’ in the pre-industrial phase, a ‘game against fabricated nature’ in the industrial era and a ‘game ... (maintaining and progressing in that employment) Overall it was anticipated that clients on the pilot aesthetic labour training programme would develop an awareness of and appreciation for aesthetic ... plan; a one-to-one session with a personal trainer; maintaining a beauty routine; receiving a professional makeover; and taking part in a photographic session • Recording a song—taking part in team...
- 20
- 830
- 0
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
Ngày tải lên :
29/03/2014, 08:20
... (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respectively ... point mutations C60F and C47 3A were introduced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 (5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) ... synthesis that only a Ppant-PCP is a substrate for an A domain and also with the idea that binding of the PCP to the A domain in a productive manner increases the compactness of the protein Further...
- 13
- 493
- 0