institute cargo clauses a b and c

So sánh Institute Cargo Clauses (A) 01/01/1982 và Institute Cargo Clauses (A) 2009

So sánh Institute Cargo Clauses (A) 01/01/1982 và Institute Cargo Clauses (A) 2009

Ngày tải lên : 01/10/2012, 14:23
... Vic thc hin c c bin phỏp nh vậy là hợp lý vì m c đích ngăn ng a < /b> ho c gim thiu c c tn tht ã iu 16.2 m bo tất c c c quyền đối với tàu, sân bay, thuyền trưởng hay c c b n thứ ba kh c đư c b o ... c b n thứ 3 đư c quyền CHƯƠNG II: Phân tích và so sánh Institute < /b> Cargo < /b> Clauses < /b> (A)< /b> 1/1/82 và Institute < /b> Cargo < /b> Clauses < /b> (A)< /b> 1/1/09 1. Những điểm tương đồng Điều kiện b o hiểm g c Institure Cargo < /b> ... ICC 2009, doanh nghiệp sẽ không biết rằng hàng h a < /b> c a < /b> mình vẫn đư c b o hiểm trong trường hợp này. C c điều kiện b o hiểm c a < /b> ICC ra đời từ 1963, qua 2 lần s a < /b> đồi và tất c c c b n đều c ...
  • 18
  • 10.5K
  • 228
Tài liệu INSTITUTE CARGO CLAUSES doc

Tài liệu INSTITUTE CARGO CLAUSES doc

Ngày tải lên : 13/12/2013, 14:15
... Despatch Clause 15. - It is a < /b> condition of this insurance that the Assured shall act with reasonable despatch in all circumstances within their control. LAW AND PRACTICE 16. - English Law and ... or salvage charges, shall be subject to the exclusions contained in Clauses < /b> 2,3 and 4 above, and shall not include charges arising from the fault negligence insolvency or financial default ... ICC -A < /b> " ;Institute < /b> Cargo < /b> Clauses < /b> Air" INSTITUTE < /b> CARGO < /b> CLAUSES < /b> (Air) RISKS COVERED 1. - Risks Clause 1 - This insurance covers all risks of loss of or damage to the subject-matter...
  • 5
  • 385
  • 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Ngày tải lên : 18/02/2014, 04:20
... of ETA infection, as assessed by the mitochondrial release of cytochrome c, caspase-9 and caspase-3 activa- tion, and DNA fragmentation. In an in vitro assay, intact ETA induced ADP-ribosylation ... [42]. Caspase-3, caspase-8 and caspase-9 activity was analyzed with a < /b> fluorometric assay kit (BioVision, Mountain View, CA, USA) with the respective DEVD-AFC, IETD-AFC and LEHD-AFC sub- strates. ... monoclonal antibody directed against rat EEA1 was purchased from Transduction Laboratories. Mouse monoclonal antibody directed against rat cytochrome c was purchased from Pharmingen. Rabbit polyclonal...
  • 15
  • 588
  • 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Ngày tải lên : 18/02/2014, 17:20
... 5Â-gttatggatctgct accgcggctccgatcctaaacg-3Â; mutation K201F, 5Â-ggttatggatctg ctacttcgctccgatcctaaacgc-3Â; and mutation M45 3A,< /b> 5Â-ggacaa ctttgaatgggcggagggttatattgag-3Â. The incorporation of muta- tions ... listed, as follows: mutation E19 0A,< /b> 5Â-caacgagcctagagcgatttgctttgagg-3Â; mutation E190Q, 5Â-caa cgagcctagacagatttgctttgagg-3Â; mutation E19 4A,< /b> 5Â-gagagattt gctttgcgggttatggatctgc-3Â; mutation K20 1A,< /b> ... mechanism of substrate (agly- cone) specificity in b- glucosidases is revealed by crystal structures of mutant maize b- glucosidase-DIMBOA, - DIMBOA-Glc and dhurrin complexes. Proc Natl Acad Sci...
  • 12
  • 731
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20
... AHRQ Agency for Healthcare Research and Quality AIDS Acquired immunodeficiency syndrome ALT Alanine aminotransferase anti-HBc Hepatitis B core antibody anti-HBs Hepatitis B surface antibody ... xii ACRONYMS AND ABBREVIATIONS AASLD American Association for the Study of Liver Diseases ACIP Advisory Committee on Immunization Practices ACOG American College of Obstetricians and Gynecologists ... antibody anti-HCV Hepatitis C antibody API Asian and Pacific Islander AST Aspartate transaminase AVHPC Adult viral hepatitis prevention coordinators CDC Centers for Disease Control and Prevention...
  • 191
  • 457
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20
... LIVER CANCER AND LIVER DISEASE FROM CHRONIC HEPATITIS B VIRUS AND HEPATITIS C VIRUS INFECTIONS Both chronic HBV and HCV infections can lead to HCC, a < /b> type of liver cancer, and liver disease (But ... Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Car- ing Ambassadors Program; Joan Block, ... Hepatitis B and C http://www.nap.edu/catalog/12793.html 20 HEPATITIS AND LIVER CANCER Tobacco Other causes Malaria Non-HIV TB Road accidents vCJD Hospital infection Suicide Log 10 global death rate...
  • 253
  • 369
  • 0
Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx

Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx

Ngày tải lên : 07/03/2014, 15:20
... Gaudiano, M .C. , Rotella, S., Benagiano, G. & Pala, A.< /b> (2000) Effect of pH on the structure and aggregation of human glycodelin A.< /b> A < /b> comparison with b- lactoglobulin A.< /b> Biochim. Biophys. Acta ... sandrade@popsrv.ist.utl.pt Abbreviations: AOT, sodium bis(2-ethylhexyl) sulfosuccinate; bLG, b- lactoglobulin; DAS, decay associated spectra; GdnHCl, guanidine hydrochloride; NAT, N-acetyltryptophan; NATA, N-acetyltrypto- phanamide; ... sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A < /b> fluorescence and CD study Suzana M. Andrade, Teresa I. Carvalho, M. Isabel Viseu and Sı ´ lvia M. B. Costa Centro de Quı ´ mica Estrutural,...
  • 11
  • 523
  • 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Ngày tải lên : 16/03/2014, 05:20
... similarly by using the synthesized oligonucleotides 5Â-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3Â and 5Â-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, ... ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, and 5Â-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ATGG TGGT-3Â, respectively. pBOS-HA-pVHL was constructed by inserting ... 5Â-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3Â, into the XbaI site of pBOS Vector. pBOS-Myc and pBOSFlag were constructed similarly...
  • 9
  • 420
  • 0
Báo cáo khoa học: Photosynthetic acclimation: Structural reorganisation of light harvesting antenna – role of redox-dependent phosphorylation of major and minor chlorophyll a/b binding proteins pot

Báo cáo khoa học: Photosynthetic acclimation: Structural reorganisation of light harvesting antenna – role of redox-dependent phosphorylation of major and minor chlorophyll a/b binding proteins pot

Ngày tải lên : 16/03/2014, 06:20
... indi- rect biochemical, spectroscopic and immunolocaliza- tion data. We postulate that under some conditions CP29 acts as a < /b> sole monomeric Cab protein that increases the absorption cross-section ... Johnson MP, Havaux M, Triantaphylides C, Ksas B, Pascal AA, Robert B, Davison PA, Ruban AV & Hor- ton P (2007) Elevated zeaxanthin bound to oligomeric LHCII enhances the resistance of Arabidopsis ... additional density observed in the State 2 LHCI–PSI supercomplex, which is able to accommodate an additional Cab sub- unit, is indicated with a < /b> white arrow in (B) and coloured in red in (E) and corresponds...
  • 13
  • 343
  • 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Ngày tải lên : 16/03/2014, 18:20
... GAG as the mutated codons for Q39N and Q39E, respectively. For mutation at position E451, the primer sequence was 5Â- GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3Â,withGAC,CAAandTCA as mutated ... substrates presenting a < /b> variety of glycones (mono- saccharides such a < /b> s glucose, galactose, fucose, mannose, 6-phosphoglucose and 6-phosphogalactose) and aglycones (monosaccharides, oligosaccharides, ... which may actually be composed of several subsites (+1, +2, +3, etc.). According to the CAZy database, family 1 currently comprises 427 b- glycosidases, with 3D structural data being available...
  • 9
  • 371
  • 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Ngày tải lên : 17/03/2014, 10:20
... prokaryotic 16S rDNA universal primers 27f (5Â-AGAGTTTGATCCTGGCTCAG-3Â )and 1522r (5Â-AAGGAGGTGATCCARCCGCA-3Â) and puri- ed as described [8]. 16S rDNA was sequenced using a < /b> Big Dye Terminator ... order Actino- mycetales) contain teichoic acids, the anionic glycopolymers which are covalently bound to peptidoglycan and are situated between other cell wall layers and at the cell surface. They ... A < /b> polymer with a < /b> backbone of 3-deoxy- D - glycero - D - galacto -non-2- ulopyranosonic acid, a < /b> teichuronic acid, and a < /b> b- glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM...
  • 6
  • 561
  • 0
Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Ngày tải lên : 17/03/2014, 17:20
... b- alanine or b- aminobutyric acid, c- aminobutyric acid and e-amino caproic acid were not activated. Thus, the activating enzyme appears to be strictly speci c for b- lysine . The strict speciđcity ... activate aromatic carboxylic acids or an amino acid such as alanine as adenylates 9 ,whichin turn are loaded to speci c PCP domains. These PCP- domains are e ither alone-standing PCPs, as i n ... various oligonucleotide primers for PCR The pair pcp 15, GAG CACGGCMGRGAGGAGGC/PCP; 6, SGCSARGTG SCCSACSGT gave a < /b> clone encoding a < /b> partial sequence of NpsB. DNA manipulations All DNA manipulations were...
  • 11
  • 559
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Ngày tải lên : 22/03/2014, 17:20
... that the CDC develop speci c agreements with all state and territorial health departments to sup- port core surveillance for acute and chronic hepa- titis B and hepatitis C, and conduct targeted ... York Sandral Hullett CEO and Medical Director, Cooper Green Hospital, Bir- mingham, Alabama Stacene R. Maroushek Staff Pediatrician, Department of Pediatrics, Hennepin County Medical Center, ... and that there are several bar- riers to prevention and control efforts, such as a < /b> lack of knowledge and awareness about chronic viral hepatitis among health care providers, at- risk populations,...
  • 4
  • 404
  • 1
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Ngày tải lên : 23/03/2014, 21:20
... mammals. Then, the pUC18 containing the mutated b- T1 was used as a < /b> template in a < /b> PCR with the oligonucleotides 5Â-CGAGCTCGG TACATATGAGAG-3Â, as forward primer, and 5Â-TCGACTCTAGAGGATCCCC-3Â, as ... coevolution between CCT and actins and tubulins [22]. Euplotes focardii is a < /b> ciliated protozoan endemic to Antarctic coastal seawater, which shows optimal survival and multiplication rates at 4–5 C [23]. ... from rabbit reticulocyte lysate by the chromatographic methods described by Gao et al. [7]. Fractions containing CCT that emerged from the ATP- agarose were pooled and concentrated by ultrafiltration (Centricon...
  • 7
  • 500
  • 0
Báo cáo khoa học: Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi potx

Báo cáo khoa học: Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi potx

Ngày tải lên : 30/03/2014, 10:20
... GCC GTC ATC C- 3Â; CF2NotI 5Â-TT GCG GCC GCG CCC GGC GCG GAA CCC-3Â; CF5NdeI 5Â-AA CAT ATG ATC GAC CTG ACC GCA GCC-3Â; CF5XhoI 5Â-AA CTC GAG GTG GGT GTC CCA CTG GCC-3 Â. PCR mixtures contained ... University of British Columbia. N-Acetylchitooligosac- charides (Dp 2–6) were from Seikagaku America (Fal- mouth, MA, USA). Chromogenic substrates and hyaluronic acid were from Sigma. 4MU-GlcNAc and DNP- 2FGlc ... recycling and b- lacta- mase induction. J Biol Chem 275, 39032–39038. 22 Keyhani NO & Roseman S (1999) Physiological aspects of chitin catabolism in marine bacteria. Biochim Biophys Acta 1473,...
  • 13
  • 449
  • 0