insertion through a peg
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day with a thin, sleeveless dress over a light camisole, ... United States Barack Obama who has made a history in American presidency to be the first black to hold the office African American have gained recognizable stand in American society that they ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
- 49
- 785
- 1
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source
... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... m7 = A6 = − A5 + A4 + A3 , A7 = A1 0 = A7 − A8 + A9 , B1 = A1 m5 (m3 − m5 )(m4 + m5 ) , A8 = A1 m1 (m3 − m1 )(m4 + m1 ) , A9 = A2 m7 (m3 − m7 )(m4 + m7 ) , 2 A1 A3 Pr G r A1 A5 Pr G r − A1 A4 Pr ... field are magnetic parameter M, permeability parameter Kp, Grashof number for heat transfer Gr and heat source parameter S The effects of these parameters on the velocity field have been analyzed...
- 12
- 428
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual ... (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin from bovine pancreas...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx
... ubiquitination is unlikely to be related to a defective membrane interaction While being persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several ... that the stimulation of Rac1-dependent pathways may, in some way, activate the Rac1 ubiquitination machinery As Rac1b has been shown to display reduced capacity to bind POSH [28] and to activate ... ligase Itch Science 306, 271–275 40 Tapon N, Nagata K, Lamarche N & Hall A (1998) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways...
- 11
- 469
- 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot
... 689–697 26 Matsufuji, S., Miyazaki, Y., Kanamoto, R., Kameji, T., Murakami, Y., Baby, T.G., Fujita, K., Ohno, T & Hayashi, S (1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA cloned ... cDNA encoding mammalian ornithine decarboxylase Proc Natl Acad Sci USA 81, 3645–3649 30 Graham, F.L & van der Eb, A. J (1973) A new technique for the assay of infectivity of human adenovirus DNA ... antizyme is a rapidly degraded protein and that as with ODC, the degradation of antizyme is also carried out by the proteasome Antizyme mRNA contains two variably used in-frame initiation codons...
- 7
- 382
- 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx
... replaced, and littering xi playing through golf cart abuse Walking car ts and riding car ts are great conveniences and can save your back, but they also can wreak havoc on other people’s golf games ... appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another lousy shot, my cart mate came over, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to...
- 223
- 404
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... process takes place Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... Tsuchiya A, Kiyono M, Nosaka T et al (2006) Rac1 and a GTPaseactivating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors J Cell Biol 175, 937–946 26 Michaelson...
- 12
- 432
- 0
Báo cáo khoa học: Organizing signal transduction through A-kinase anchoring proteins (AKAPs) docx
... proteasomal degradation or stabilization of the transcription factor HIF- 1a AKAP signaling AKAP-Lbc signaling complex AKAP-Lbc is another multivalent anchoring protein that organizes PKA and PKC ... proteins (AKAP150, mAKAP and AKAP-Lbc) and their interacting partners are discussed in detail (Table 1) AKAP79/150 signaling complexes To date, AKAP150 (the murine homolog of human AKAP79) remains ... classic enzyme feedback loop because anchored PKA activity eventually leads to the termination of cAMP signals Interestingly, the same AKAP A B C D Fig mAKAP signaling complexes (A) mAKAP assembles...
- 6
- 357
- 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc
... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28] The locations of P1, P2 and P3 at the p16 ... isothiocyanate-conjugated goat anti-(rabbit serum) as secondary antibody, incubated with rat anti-3MeK9H3 serum and stained with TRITCconjugated goat anti-(rat serum) as secondary antibody, and finally ... data The target RNAi sequence for ZBP-89 was 5¢-GAGCAGAAGCAGGTG CAGA-3¢ [29] The p16-targeting siRNA sequence was 5¢-GAGGAGGTGCGGGCGCTGC-3¢ [18] An oligonucleotide that represents the small hairpin...
- 10
- 374
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... acid-substituted SP analogues [HGly9]SP, [b2-HAla9]SP and [b3-HAla9]SP may adopt conformations around residue that are analogous to those adopted by a- amino acids (Gly, Ala, Sar, Pro) To explain the slightly ... solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for ... was performed to analyze structure–activity relationships Experimental procedures Molecular mechanics calculations N-acetyl N¢-methyl amide derivatives of HGly, b2-HAla and b3-HAla and of a- amino...
- 11
- 860
- 0
Reducing Childhood Obesity in Ontario through a Health Equity Lens docx
... food, clean air, affordable child care, accessible and affordable recreation services, and access to high quality health care 23 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, ... health is far higher for marginalized populations Health inequities – differences in health outcomes that are avoidable, unfair, and systematically related to social inequality and disadvantage ... Determinants of Health and Populations at Risk’, p 29 29 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, p 29 30 Raine, Overweight and Obese in Canada: A Population Health...
- 13
- 322
- 0
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
... Biotechnology, Santa Cruz, CA, USA); cleaved caspase-3, rabbit polyclonal anti-cleaved caspase-3 (Asp175) (#9661; Cell Signaling Technology, Danvers, MA, USA); caspase-9, rabbit polyclonal anti-caspase-9 ... Yasuda K, Nakai A, Hatayama T & Nagata K (1995) Cloning and expression of murine high molecular mass heat shock proteins, HSP105 J Biol Chem 270, 29718– 29723 Ishihara K, Yasuda K & Hatayama ... of caspase-3 mediated by heat shock In mammalian cells, one of the main pathways that activates procaspase-3 is via mitochondria When the mitochondria receive appropriate signals from a variety...
- 13
- 215
- 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... [9] at the linker region was constructed by amplifying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ ... prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes Proc Natl Acad Sci USA 97, 559–564 Sawasaki, T., Hasegawa, Y., Tsuchimochi, M., Kamura, N., Ogasawara, ... Kawasaki et al (Eur J Biochem 270) Antigen-binding analyses We then examined the antigen binding activity The soluble material from each reaction was loaded on an antigen column and was separated...
- 7
- 330
- 0
synthesis and growth of hematite nanodiscs through a facile hydrothermal approach
... Electronica S.L., Spain); The Brunauer–Emmett–Teller (BET) surface area of the as-prepared particles was measured at 77 K (liquid nitrogen) on a Quantachrome Autosorb-6B Surface Area & Pore Size Analyzer ... 10b The measured curves for calculating BET surface area of particles were plotted and analyzed It can be seen that the surface area of aFe2O3 nanodiscs (triangle spotted lines) was estimated to ... probably caused by the fast hydrolysis rate at a high pH (*3.0) The diffraction rings in the SAED patterns (inset of Fig 6, panels a c) revealed that the as-prepared nanoparticles are of crystalline...
- 17
- 623
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... apparatus using a PrePak Cartridge 25 · 100 mm (Agilent) casted on a PrepLC Universal Base apparatus (Waters) and a Zorbax 300SB-C18 9.4 · 250 mm (Agilent) Samples were eluted using a linear gradient ... Fmoc-protected amino acids were purchased from ChemImpex International (Wood Dale, IL, USA), Fluka (Buchs, Switzerland), Advanced Biotech Italia (Seveso, Italy) and NovaBiochem (Darmstadt, Germany) TentaGel ... of experimental data with a three-parameter negative exponential curve (R > 0.99, data not shown) gave an apparent rate constant value of 0.54 min)1 for EGF-14, and values in the range 0.22–0.26...
- 12
- 416
- 0
Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx
... the abbreviation and synonymy phenomena, we construct a thesaurus and convert all manual and automatic phrases into their canonical forms when evaluated The traditional Recall, Precision and ... phrases Afterwards, our approach is evaluated against two existing approaches, which rely on the conventional semantic network and are able to capture binary relations only One approach combines ... Wikipedia and AI workshop at the AAAI-08 Conference, Chicago, US Dengyong Zhou, Jiayuan Huang and Bernhard Schölkopf 2005 Beyond Pairwise Classification and Clustering Using Hypergraphs MPI Technical...
- 5
- 367
- 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc
... mitogen-activated protein kinase pathway Proc Natl Acad Sci USA 97, 1113–1118 Yonekura, A. , Osaki, M., Hirota, Y., Tsukazaki, T., Miyazaki, Y., Matsumoto, T., Ohtsuru, A. , Namba, H., Shindo, H & Yamashita, ... otherwise specified, all experiments were repeated at least twice, with similar results One-way analysis of variance (ANOVA ) was used for statistical evaluation Statistical analysis was performed by ... Miyazaki, Y., Osaki, M., Shindo, H & Yamashita, S (2000) Activation of specific MEKERK cascade is necessary for TGF beta signaling and crosstalk with PKA and PKC pathways in cultured rat articular...
- 8
- 377
- 0
Plant reproductive susceptibility to habitat fragmentation: review and synthesis through a meta-analysis pptx
... when each point from the scatter had an associated variance measure and sample size) or calculated the mean value, standard deviation and sample size from the graphs by pooling the data points ... plants in contrasting conditions (i.e habitat fragmentation taken as a categorical factor) In most of the papers, response variables were compared between small habitat fragments (or either small ... for Meta-analysis Academic Press, New York Herrera, C.M (1996) Floral traits and plant adaptation to insect pollinators: a devil’s advocate approach In: Floral Biology: Studies on Floral Evolution...
- 13
- 316
- 0
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc
... Michie AM, McCaig AM, Nakagawa R & Vukovic M (2010) Death-associated protein kinase (DAPK) and signal transduction: regulation in cancer FEBS J 277, 74–80 Raval A, Tanner SM, Byrd JC, Angerman EB, ... 12, which then binds to and inactivates mTORC1, leading to an upregulation of autophagy [25] Thus mTORC1 acts as a central regulator balancing anabolic and catabolic pathways within the cell [24] ... TGGCTAGTTTGACTCGTCG-3¢ Autophagy Apoptosis Fig DAPK and TSC2 form a regulatory feedback loop Recent advances have established an important role for DAPK in a diverse range of signal-transduction pathways...
- 17
- 368
- 0
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc
... References Yasuoka S, Onishi T, Kawano S, Tsuchihashi S, Ogawara M, Masuda K, Yamaoka K, Takahashi M & Sano T (1997) Purification, characterization, and localization of a novel trypsin-like protease found ... through ERK activation; (b) at least a part of HAT-induced initial ERK activation is mediated through PAR-2; (c) only HAT, and not PAR-2 AP, causes AR protein release through TACE activity; and (d) ... bronchial asthmatic patients [10] These observations suggest that HAT might mediate airway inflammation by PAR-2 activation In addition to airway inflammation, hypersecretion of airway mucus is a characteristic...
- 13
- 242
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25