inquiries revealed that dog meat is a prized food item here as quoted in dog meat a delicacy in mizoram the hindu december 20 2004 http www hindu com 2004 12 20 stories 2004122003042000 htm accessed june 9 2009
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the ... T, Ausubel FM & Sheen J (200 2) MAP kinase signalling cascade in Arabidopsis innate immunity Nature 415, 97 7 98 3 31 Matsui H, Miyao A, Takahashi A & Hirochika H (201 0) Pdk1 kinase regulates basal ... external stimuli and consist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAPKK) and finally a MAPK [ 19] However, little is known about the function and composition...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... Nucleolin was first described as a major nuclear protein consisting of a negatively charged N-terminal domain, an RNA-binding domain and a C-terminal domain rich in RGG motifs [54] Nucleolin has been ... of the staining localized to developing muscle (Fig 4B) Increased magnification showed that the most intense staining was, as with the RAP stain, within the myotubes and on myotube surfaces (arrow ... predict that an antibody raised to a sequence outside this domain might have little effect on the RAP assay signal This was tested with an antibody to nucleolin raised against amino acids 271– 520 No...
- 14
- 669
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... phase and the pellet showed identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as ... of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that the terminal NeuAc ... This implies that not only the furanosidic linkage is acid-labile, but also that of the b-D-GalNAc residue Thus, assuming that the linkage second most easily hydrolyzed is that of the acetamidohexose,...
- 7
- 463
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... within the 56-amino-acid MADS box at their N-termini and within an adjacent 29- amino-acid region referred to as the MEF2 domain The MADS box is essential for DNA binding and dimerization, and the ... gene The axon emanating from the somata (light blue arrowheads and enlarged image shown in E) runs towards the midline of the brain with some arborization (boxed area in A) , contralateral after ... throughout the brain lobes and at the midline in the subesophageal ganglion (SG) (Fig 1A) The axons emanating from the somata of the two pairs of lateral cells extend towards the pars intercerebral with...
- 10
- 437
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... phosphorylase phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism ... synthase by insulin and GSK-3 inhibitors indicates that insulin activates glycogen synthase by mechanisms additional to inactivation of GSK-3 This can be explained, at least in part, by the inactivation ... dexamethasone, insulin caused a rapid and sustained decrease in the activity of phosphorylase a at both mM glucose (40% decrease) and 25 mM glucose (60% decrease) The inactivation by insulin was...
- 9
- 381
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... some details from that against dinucleotides [18, 19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pKa values of the active ... 3) R121K and R121Q displayed a decreased stability in comparison to the wild-type protein Denaturation of these proteins was studied by analysing the thermal variation of their far-UV circular ... results obtained indicate that the loss of a positive charge in the position corresponding to Arg121 side-chain has a dramatic effect on the a- sarcin–membrane interaction Regarding to this, the region...
- 7
- 434
- 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
... NRP -A and NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved ... using ApoAlert ® Caspase Colorimetric Assay Kit (Clontech), according to the manufacturer’s instructions, at pH 7.4 The substrate was DEVD-pNA and the inhibitor of caspase 3-like activity was the ... expression to activate an osmotic- and ER-stress integrating pathway, also called the integrated pathway The enhanced accumulation of membrane-associated NRPs activates a cascade to induce the expression...
- 14
- 254
- 0
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx
... T-AGCCGTGTGCTATGTGAAAGATGGCAG-GCTTAAAAAAT human TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT ... TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAAGGGGT TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT ... TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT TTAGCTGTGT CATGATAAAGATAGCAC-CTATATTTGAT tetr danio TTAATCTGGTGCTTTGTGCAGTAAAACAG-TTCTACAGAAT refereed research fugu deposited research 5‘ SCE Rat Dog reports...
- 19
- 510
- 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... (Promega Corporation, Alexandria NSW, Australia), and detected on a Wallac 1 420 luminometer (Perkin Elmer, Waltham, MA, USA) βGalactosidase activity was determined using the β-Galactosidase Enzyme Assay ... SW, Hannon GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 200 5, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, ... additional data are available with the online version of this paper Additional data file is a table listing the G1/S associated mRNAs predicted to be targets of miR-17-5p Additional data file is a...
- 14
- 331
- 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, endocrine pancreas and exocrine pancreas, which carry out essential physiological functions The endocrine pancreas ... of gastrulation; sox17 expression is maintained in the forerunner cells and finally disappears in early somitogenesis (Alexander and Stainier, 199 9; Dickmeis et al., 200 1; Kikuchi et al., 200 1) ... establishment of the apical-basal polarity in the intestinal epithelium between 60 and 72 hpf, revealed by the expression of alkaline phosphates, cytokeratins and E-cadherin (Pack et al., 199 6;...
- 199
- 296
- 0
ĐỀ TÀI TỶ LỆ THẤT NGHIỆP Ở VIỆT NAM.Generated by Foxit PDF Creator © Foxit Software http://www.foxitsoftware.com For evaluation only.Lêi nãi ®ÇuNgµy nay víi sù ph¸t triÓn vît bËc cña khoa häc kü thuËt ®· kh«ng Ýt t¹o ra nhòng sù nh.y vät vÒ mäi mÆt potx
... Generated by Foxit PDF Creator â Foxit Software http: / /www. foxitsoftware .com For evaluation only kinh doanh,đồng thời tăng cường hợp tác quốc tế,tranh thủ vốn đầu tư nước ngoài.Với mở c a ta năm ... khỏi lực lượng lao động muốn quay lại làm việc ch a tìm việc làm Generated by Foxit PDF Creator â Foxit Software http: / /www. foxitsoftware .com For evaluation only Như thất nghiệp số mang tính thời ... Xây dựng phát triển mạng lưới thông tin thị trường lao động quốc gia 12 Generated by Foxit PDF Creator â Foxit Software http: / /www. foxitsoftware .com For evaluation only Thành lập hệ thống hội đồng...
- 17
- 723
- 0
Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com CONTENTS CONTENTS C H A P pdf
... given as additional information and is not a direct example of the current chapter (c) The blackheart malleable cast iron obtained after annealing in an inert atmosphere have a black fracture The ... unfortunately, has the same name as the unit of mass The weight of a body is measured by the use of a spring balance, which indicates the varying tension in the spring as the body is moved from place ... heated to a temperature of 90 0 to 95 0°C and maintained at this temperature for several days During this period, some of the carbon is oxidised out of the castings and the remaining carbon is dispersed...
- 1,178
- 526
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... dehydrogenase-ferrochelatase from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity A crystal structure of Met8P has shown that this protein has an aspartate residue ... Asp1 29 is important for folding of the recombinant protein FEBS Journal 277 (201 0) 494 4– 495 5 ª 201 0 The Authors Journal compilation ª 201 0 FEBS 494 9 Periplasmic NirF binds d1 heme S Bali et al ... resulting d1 heme then being translocated to the periplasm In the case of P pantotrophus it would be the substrate for NirF that is translocated In either case the transport process is enigmatic as...
- 12
- 613
- 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
... was then obtained as shown in Figure 2B The VLIGGSFY sequence matched several mouse peptidylarginine deiminases (PAD) when searched using BLAST against the NCBI nonredundant database These included ... were stained by anti-PAD V (N) At the 8-cell stage, anti-PAD V (N) labeling was still associated with the blastomeres' plasma membranes, and the label was diffuse around the blastomeres surface ... comparing distribution of PAD and LCA-binding cortical granule components in in vivo Confocal Confocal scanning laser micrographs comparing distribution of PAD and LCA-binding cortical granule components...
- 22
- 519
- 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
... generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, ... 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢ Experimental procedures Mutagenesis The Pf TIM gene was cloned into the pTrc9 9A vector pARC1008 ... determination for the datasets of C126S-liganded The structure with the PDB ID of 1O5X was used as the starting model in the case of the datasets for C126S-unliganded and C12 6A The coordinates...
- 12
- 393
- 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... needs are great A Mother’s Story A single African-American mother in her twenties with a learning disability and chronic asthma has a son who was born premature and has several serious health complications, ... problems that fall outside their areas of expertise Integrated Information Resources A few programs have integrated data systems that enable case managers or care coordinators to track individual families ... evaluation on process and outcomes data provided by the individual teams, as well as changes on key indicators of family engagement and care coordination measured first at baseline and then at...
- 79
- 343
- 0
Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf
... and the bases released were analyzed by HPLC The peaks indicated by an open arrowhead and a closed arrowhead were compared with peaks of standard samples, and were identified as adenine base and ... Each point and error bar indicates the mean and standard deviation of three reactions FEBS Journal 276 (200 9) 1654–1666 ª 200 9 The Authors Journal compilation ª 200 9 FEBS M Nonaka et al A mammalian ... hypoxanthine base, respectively The peak indicated by an asterisk was also observed in a sample released from agarose without any nucleotide, suggesting that it was derived from the carrier agarose...
- 13
- 424
- 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx
... 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted ... double-stranded (ds) oligonucleotide (T4¢¢), obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides ... approximately a 20- fold increase in the same assay system In addition, T20 activated transcription in an EBVori-containing episome and, most interestingly, in the genome of all stable transformants...
- 12
- 399
- 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... between the amino acids side chains of residues Thr10 and Ala12 and the carbohydrate moieties of GalNAc (GN) and Gal (G) The individual amino acids Thr10, Ala12 are represented by 10T and 1 2A, respectively, ... derivatives during the solid-phase glycopeptide synthesis The amino acids are numbered starting from the amino terminal according to accepted nomenclature As solid-phase peptide synthesis starts ... have taken advantage of this post-translational modification in unique ways that allows them to accommodate evolutionary and environmental changes that are specific for each species These data...
- 11
- 563
- 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC ... CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG F: CTACTTTTGATCTTCTAAAGAGGC S: TGGAGCCATCTCTCAGACTTGGG ... GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG S: GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC...
- 16
- 363
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008