influenza a virus multiplication and the cellular sumoylation system

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Ngày tải lên : 18/06/2014, 18:20
... extravascular spaces of airway tissues and, in the case of IgG, transudated further into the airway lumen or, in the case of IgA and IgM, became transported through the epithelial cell layer ... e-max ELISA reader and analyzed with Softmax Pro software (both Molecular Devices, Sunnyvale, CA) Statistical analyses Prism software [64] was used for plotting and statistical analysis of data ... Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody-forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration...
  • 14
  • 515
  • 0
Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

Ngày tải lên : 12/08/2014, 04:21
... X-Gal medium and lack of the reporter β-galactosidase enzymatic activity As controls, an AD-peptide aptamer anti-LexA (Ctr+), but not an irrelevant AD-aptamer (Ctr-), reacted with all Lex-Abaits, ... 5'-CATGAATTCATGGGAACCCCAAAGCCA-3' and backward 5'-TGACTCGAGTCAGCTCTCCCCAGGGCC-3' primers containing EcoRI and XhoI restriction sites (bold), respectively The cDNA was subcloned downstream the myc tag ... expressed as a stable latent transactivator of the cellular innate immune response [25] It belongs to the family of interferon regulatory factors (IRF) and acts as a transactivator for the interferon-β...
  • 17
  • 308
  • 0
Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 1

Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 1

Ngày tải lên : 11/09/2015, 09:58
... NUS, Singapore for providing H3N2 virus- derived DNA constructs I also thank Dr Alexander N Zakhartchouk, University of Saskatchewan, Canada for providing the human adenovirus vector and Mia Brytting, ... Disease Control and Mikael Berg and Siamak Zohari, Swedish National Veterinary Institute, Sweden for providing the H5N1 influenza A viruses isolated in Sweden I also thank Prof Chan Soh Ha, NUS, ... and encouragement Last but not least, sincere appreciation and thanks to my family for their patience and support all these years Author’s publications Hsueh-Ling Janice Oh, Sara Akerstrom,...
  • 4
  • 172
  • 0
Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 2

Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 2

Ngày tải lên : 11/09/2015, 09:58
... coronavirus (SARS-CoV) and the H5N1 influenza A virus Together with innate immunity, the host adaptive immune responses are crucial for the clearance of the virus during an infection In the first ... protein of the influenza A/ chicken/hatay/2004 H5N1 virus (clade 1) was generated and characterized Firstly, the baculovirus-expressed and purified recombinant HA (rHA) was shown to elicit neutralizing ... viral entry It was also found to be protective, both prophylactically and therapeutically, against lethal viral challenge of mice Our data suggest that mAb 9F4 could be a potential candidate...
  • 13
  • 237
  • 0
Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 3

Understanding the adaptive immune responses against newly emerged viruses, SARS coronavirus and avian h5n1 influenza a virus 3

Ngày tải lên : 11/09/2015, 09:58
... the cytoplasm, a transmembrane domain, the stalk, the head with the catalytic active site (Varghese et al., 1983) The role of NA in the influenza virus life cycle is still unclear NA can catalyze ... globular head containing the receptor binding domain (RBD) and vestigial esterase domain, and a membrane proximal domain with central α-helical stalk and HA1/HA2 cleavage site The protein was predicted ... of the HA protein Generally, the avian and equine influenza A viruses bind preferentially to sialic acid that is linked to galactose by an α2,3-linkage (SAα2,3Gal), whereas human influenza virus...
  • 179
  • 233
  • 0
The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury

The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury

Ngày tải lên : 13/10/2015, 16:41
... thus leading to leakage of proteinaceous fluid into the alveolar space and airways The intense inflammatory response leads to damage in both pulmonary endothelial and epithelial cells, and the disruption ... stimuli, and excessive release of the proteolytic enzymes will damage and slough off the pulmonary epithelial and endothelial cells The damaged endothelium and epithelium then results in ALI and ARDS ... of the capillary-alveolar barrier function results in the leakage of inflammatory exudates, edema fluid and plasma proteins into the lung interstitial and alveolar spaces The loss of epithelial...
  • 181
  • 496
  • 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Ngày tải lên : 23/03/2014, 09:21
... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow ... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ... constructed from at least six standards which were prepared using control cell lysates as solvent Sample analyte content was calculated from the analyte response ratio and the slope of the calibration curve,...
  • 8
  • 331
  • 0
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Ngày tải lên : 20/06/2014, 01:20
... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and analyzed for discrepancies at the 3'end The ... 41.5% females The blind samples encompass a selection of influenza A viruses, influenza B viruses, and adenovirus (n = 37 influenza A, n = 25 influenza B, n = adenovirus) Viral RNA was extracted ... Type "A" viruses are the most important pathogens of the three types and have been associated with all of the past influenza pandemics [4,5] Influenza A viruses are classified into subtypes according...
  • 11
  • 378
  • 0
Novel Influenza A (H1N1) Outbreak at the U.S. Air Force Academy Epidemiology and Viral Shedding Duration pptx

Novel Influenza A (H1N1) Outbreak at the U.S. Air Force Academy Epidemiology and Viral Shedding Duration pptx

Ngày tải lên : 01/08/2014, 16:21
... on August after Statistical Analysis the remainder of the student body ( 3000 cadets) reData were accumulated in a spreadsheet program and anaturned to campus Upon arriving on campus, each cadet ... outbreak may be attributable to the stringent physical requirements for acceptance at the USAFA The mean duration of illness, however, was greater than days, and a small subset of cadets was subsequently ... transcriptase–polymerase chain reaction (rRT-PCR).1 All specimens were tested for influenza A; influenza B; respiratory syncytial virus; parainfluenza 1, 2, and 3; and adenovirus However, only nH1N1 was...
  • 7
  • 318
  • 0
Báo cáo y học: " Influenza A virus NS1 gene mutations F103L and M106I increase replication and virulence" potx

Báo cáo y học: " Influenza A virus NS1 gene mutations F103L and M106I increase replication and virulence" potx

Ngày tải lên : 11/08/2014, 21:21
... interpretation of data as well as drafting the manuscript SW participated in the acquisition, analysis and interpretation of data JP participated in the acquisition, analysis and interpretation of data ... acquisition, analysis and interpretation of data YL participated in the acquisition, analysis and interpretation of data EGB contributed to the study’s conception and design, data acquisition, analysis and ... Organs were sonicated on ice and viral titer was assessed by plaque assay Values are shown as averages +/- standard deviation at day pi and +/- standard error for the rest of the time points D...
  • 13
  • 223
  • 0
Báo cáo y học: " Analysis of the PDZ binding specificities of Influenza A Virus NS1 proteins" ppt

Báo cáo y học: " Analysis of the PDZ binding specificities of Influenza A Virus NS1 proteins" ppt

Ngày tải lên : 11/08/2014, 21:21
... binding affinity for Dlg Upper panel The cartoon shows the last 11 amino acid residues of Avian (A) and Human (H) NS1, together with the non-PDZ-binding mutant of Avian NS1 (Aa), plus the avian human-like ... to analyse any differences between the PDZ-binding activities of the human and avian NS1 proteins A PDZ array assay had previously been reported, using a large number of isolated PDZ domains, and ... (Ah) and the human avian-like (Ha) mutants Lower panel GST pulldown assay using these NS1 proteins To address these questions we repeated the GST pulldown assays using the two halves of the MAGI-1...
  • 9
  • 295
  • 0
Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

Ngày tải lên : 12/08/2014, 01:21
... gene annotation files and raw data were extracted into MS EXCEL Data Analysis Data was analyzed using GENOWIZ Microarray and Pathway analysis tool (Ocimum Biosolutions, Hyderabad, India) Replicated ... 5′ CATGAAGTGT GACGTGGACATCC 3′; b- ACTIN RP 5′ GCTGATCCACATCTGGAAGG 3′; BCL2 FP 5′ GATGTCCAGCCAGCTGCACCTG 3′; BCL2 RP 5′ CACAAAGGC ATCCCAGCCTCC 3′ down-regulated However, it was found that the ... performed the experiments AKC, VCV, SM performed data analysis and bioinformatics studies AKC, SM and ACM wrote the paper All authors read and approved the final manuscript Competing interests The authors...
  • 11
  • 507
  • 0
Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc

Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc

Ngày tải lên : 12/08/2014, 02:20
... Koriazova L, Madura L, Shapiro L, Matsumoto A, Yoshida A, Mikayama T, Kubo RT, Sarawar S, Cheroutre H, Kato S: Therapeutic potential of a fully human monoclonal antibody against influenza A virus ... protection as a universal passive immunotherapeutic agent against seasonal and pandemic influenza viruses [66-69] Sui et al [70] obtained a panel of highaffinity human antibodies that bind to the highly ... human influenza A strains It is therefore an attractive target for preparation of a universal influenza A vaccine In contrast to hemagglutinin and neuraminidase, eM2 is a Staneková and Varečková Virology...
  • 13
  • 325
  • 0
Báo cáo y học: "Caveolin-1 influences human influenza A virus (H1N1) multiplication in cell culture" docx

Báo cáo y học: "Caveolin-1 influences human influenza A virus (H1N1) multiplication in cell culture" docx

Ngày tải lên : 12/08/2014, 04:20
... swine influenza origin, and the recent occurrence and rapid dissemination of oseltamivir-resistant human influenza strains are motors that have accelerated the search for new antiviral targets and ... Schmitt AP, Lamb RA: Influenza Virus Assembly and Budding at the Viral Budozone Advances in Virus Research 2005, 64:383-416 Chen BJ, Leser GP, Morita E, Lamb RA: Influenza virus hemagglutinin and ... found, that the yield of human influenza virus progeny is affected by the presence/absence of Cav-1 The data suggest that Cav-1 can support the human influenza virus A life cycle Pulldown and co-immunoprecipitation...
  • 10
  • 236
  • 0
Báo cáo khoa học: " From where did the 2009 ''''swine-origin'''' influenza A virus (H1N1) emerge?" docx

Báo cáo khoa học: " From where did the 2009 ''''swine-origin'''' influenza A virus (H1N1) emerge?" docx

Ngày tải lên : 12/08/2014, 04:21
... Ireland, and one each in Argentina, Indonesia and Japan In the outbreaks in Argentina, Australia and Canada, at least, the pigs had not been vaccinated (Jorge H Dillon, J Keenliside and Alain Laperle, ... surveillance, and that there are probably many laboratories in the world that share and propagate a range of swine influenza viruses from different sources and continents, and also share and use ... reassortant parent are in blue, those from the Eurasian 'avian-like' swine virus lineage in red The black triangles indicate the mean and standard deviation of the values for the triple reassortant and...
  • 11
  • 315
  • 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Ngày tải lên : 12/08/2014, 04:21
... 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a Y = T or C, R = A or G LNA residues in the probe are indicated ... influenza virus in Asia: implications for pandemic control Proc Natl Acad Sci USA 2006, 103(8):2845-2850 Li KS, Guan Y, Wang J, Smith GJ, Xu KM, Duan L, Rahardjo AP, Puthavathana P, Buranathai ... assay failed to detect virus in a nasal swab and a throat swab (Table 1) This may be due to RNA degradation during long-term storage and multiple freezethaw cycles Tran Tan et al Virology Journal...
  • 5
  • 460
  • 0
Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

Ngày tải lên : 12/08/2014, 04:21
... new HA and/ or NA subtype into human population All known HA and NA subtypes are maintained in avian species, and all mammalian influenza A viruses are thought to be derived from the avian influenza ... YF carried out all analyses and drafted the manuscript AS, TK, and HO participated in the design of the study and helped to draft the manuscript All authors have read and approved the final manuscript ... both avian lineages (Av1 and Av2) have been seen sporadically in humans, they have not been maintained in the population (blue characters in Av1 and Av2, Figure 1A and 1F) Strains with the M...
  • 13
  • 342
  • 0

Xem thêm