in vitro generation of t lymphocytes from embryonic stem cells pdf

báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx

Ngày tải lên : 18/06/2014, 15:20

... supernatants in the generation of Treg in vitro is demonstrated in the present study, little is known about the impact of fusion cell vaccination on generating Treg The negative impact of fusion ... cell vaccine is still not clear in this experimental setting A recent study has demonstrated that vaccination with DCs/tumor fusion cells producing TGF-β resulted in the induction of Treg in vivo ... mixture of DCs and the HCC cells in vitro (data not shown) Taken together, these results indicate that vaccination with autologous FCs is able to enhance the induction of WT1- and CEA-reactive...

19
459
0

Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot

Ngày tải lên : 09/08/2014, 09:20

... radioresistance The results of our study indicate that the enzymatic GOX/CAT system is an attractive alternative technique for in vitro investigation of tumor hypoxia Methods Cell culture The human ... irradiation of the cells in order to investigate whether the enzymatic GOX/CAT system could be used for in vitro investigation of hypoxia related radioresistance The comparison with the established ... demonstrating the complexity of pathways and mechanisms in respect to microenvironment adaptation of tumor cells The enzymatic GOX/CAT system has however a critical limitation that needs to be...

12
306
0

Báo cáo y học: "Argon: Neuroprotection in in vitro models of cerebral ischemia and traumatic brain injury" pdf

Ngày tải lên : 13/08/2014, 20:21

... Reducing the complex functions of the in vivo state to in vitro settings bears both benefits and disadvantages which have to be taken into account when interpreting The possible effects of argon ... that GABA agonists inhibited pro-apoptotic pathways through activation of the phosphoinositide 3-kinase/protein kinase B cascade [56] These findings can be a starting point for further studies to ... proapoptotic mediator pathways [44-46] Since medical intervention cannot rescue directly traumatized, dying cells, cells near the impact site surviving the initial assault are the main target for the...

9
333
0

Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Ngày tải lên : 07/08/2014, 20:23

... DHT attenuated the LPO formation The findings of this study demonstrated that the protective effects of DHT were associated with the inhibition of LPO generation, which is consistent with the ... [17,29,35] Antioxidants have been shown to attenuate the activation of MAPKs signaling [29,58], thereby indicating that the MAPK signaling pathway is an important target of ROS The levels of intracellular ... results of previous reports [40,62] Bennett et al [7] reported that testosterone with a keto group at the C3 position, showed a mild preventive effect compared to DHT Thus we suggest that the protective...

10
263
0

Báo cáo sinh học: "In vitro migration of cytotoxic T lymphocyte derived from a colon carcinoma patient is dependent on CCL2 and CCR2" pot

Ngày tải lên : 18/06/2014, 19:20

... GCA TGG GTT TTA TTA TAT ATA TAT-3’ and 5’-TTT AAA AAT AAC TGA TAT TCA TGG-3’ for CCL11; 5’-TCA TCT TTC CAC AAT AAC ATA TTT A-3’ and 5’-GTT TAT TTG AGT ATT GCT GAT CTT T- 3’ for CCL13; 5’-GGA CTT ... microscope using appropriate filters Arrows indicate binding of CTL007 to the tumor cells with fibroblasts in the reconstruct [38,39] This interaction results in the activation of both lymphocytes and ... optimum constriction of the collagen gel of reconstruct cultures The ratio of apoptotic tumor cells was determined by counting apoptotic nuclei and intact tumor cells in sections stained with...

11
370
0

báo cáo hóa học:" In vitro migration of cytotoxic T lymphocyte derived from a colon carcinoma patient is dependent on CCL2 and CCR2" pptx

Ngày tải lên : 20/06/2014, 03:20

... GCA TGG GTT TTA TTA TAT ATA TAT-3’ and 5’-TTT AAA AAT AAC TGA TAT TCA TGG-3’ for CCL11; 5’-TCA TCT TTC CAC AAT AAC ATA TTT A-3’ and 5’-GTT TAT TTG AGT ATT GCT GAT CTT T- 3’ for CCL13; 5’-GGA CTT ... microscope using appropriate filters Arrows indicate binding of CTL007 to the tumor cells with fibroblasts in the reconstruct [38,39] This interaction results in the activation of both lymphocytes and ... optimum constriction of the collagen gel of reconstruct cultures The ratio of apoptotic tumor cells was determined by counting apoptotic nuclei and intact tumor cells in sections stained with...

11
454
0

Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx

Ngày tải lên : 13/08/2014, 23:20

... embryo at 2–3d post fertilization consists of just 4–8 cells, all of which are totipotent In contrast to the pluripotent cells obtained from the blastocyst ICM, one or two of these blastomeres ... other investigators have noted that it is not currently possible to transform a single blastomere into stem cells without recourse to formation and intentional destruction of whole blastocysts ... prominently in the informed consent for patients contemplating PGD [22] Currently, a technique to determine the extent of embryo mosaicism without disassembling the embryo (and thus rendering it...

8
368
0

in vitro release of ketoprofen from proprietary and extemporaneously manufactured gels

Ngày tải lên : 13/04/2014, 09:25

... slope The assumptions in this treatment are that the drug is the only component diffusing out of the vehicle, that sink conditions are maintained in the receptor phase and that D is constant with ... parameter of the skin in the direction of that of the permeant The solubility of the permeant in the outer layers of the skin will be increased and this, in turn, improves the flux Simple solvent type ... rate of change in concentration with time at a given point in a system to the rate of change in concentration gradient at that point It is expressed in equation 1.4 where x is the diffusion distance...

222
693
0

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

Ngày tải lên : 18/06/2014, 15:20

... the MCA, measured in our study, indicates the sum of both that in the ischemic striatum and that in the non-ischemic area, such as the cerebral cortex, we consider that the rate in the rise of ... hotstart was used, followed by cycles consisting of minute denaturation at 94°C, minute annealing, and minute extension at 72°C A 10minute extension was done at 72°C after the final cycle Thirty-five ... protein concentration of these factors in culture media was not enough to be detectable Therefore, we consider that although the secretion of these angiogenic factors might have a possibility to...

14
450
0

Báo cáo khoa học: "Effect of β -mercaptoethanol or epidermal growth factor supplementation on in vitro maturation of canine oocytes collected from dogs with different stages of the estrus cycle" ppsx

Ngày tải lên : 07/08/2014, 18:20

... effect of stage of the estrous cycle on the meiotic competence of canine oocytes matured in vitro Yamada et al [35] reported that 32% of preovulatory oocytes collected from superovulated bitches ... important to mention that the outcome of our experiments was most likely influenced by the stage of the estrus cycle of the dogs from which the oocytes were collected; the positive effect of β-ME ... It is also important to mention that the outcome of our experiments was most likely influenced by the stage of the estrus cycle of the dogs; the positive effect of EGF supplementation on IVM of...

6
250
0

Báo cáo sinh học: "In vitro activities of 18 antimicrobial agents against Staphylococcus aureus isolates from the Institut Pasteur of Madagascar" doc

Ngày tải lên : 08/08/2014, 19:20

... Coquette, France The following 18 antibiotics were tested: oxacillin, penicillin, erythromycin, lincomycin, pristinamycin, vancomycin, teicoplanin, ciprofloxacin, tetracycline, minocycline, trimethoprim-sulfamethoxazole, ... are the same that those found at the chemist's and often, inpatients have to buy the medicines outside the hospital About one third of the MRSA isolates were resistant to multiple other antimicrobial ... susceptibility testing FR participated in the design of the study, the collection of strains and susceptibility testing JLS and VR drafted the manuscript and performed the statistical analysis AT conceived...

5
239
0

Báo cáo khoa học: "In vitro characterization of cells derived from chordoma cell line U-CH1 following treatment with X-rays, heavy ions and chemotherapeutic drugs" pdf

Ngày tải lên : 09/08/2014, 09:21

... PCR using KOD plus polymerase (TOYOBO, Japan) with the following primers: hTP53AF (5’ccattcttttcctgctccacaggaagccga-3’) and hTP53BR (5’ggctaagctatgatgttccttagattaggt-3’) for exons - 9, hTP53CF ... (5’-ctgtataggtacttgaagtgcagtttctac -3’) and hTP53CR (5’-ttgtaaactaacccttaactgcaagaacat -3’) for exons 10 and 11 The conditions of PCR were: 94°C, min, 35 cycles of 94°C (15 sec) and 68°C (4 min) The ... heterozygous mutation C > G, causing an amino acid substitution of proline 72 to arginine (Figure 1) Since the substitution has not been reported to confer any dominant negative effects of the...

9
377
0

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Ngày tải lên : 09/08/2014, 10:22

... addition of 1-MT, an IDO inhibitor These findings suggest that the functional activities of IDO from tolerized mice could affect the T- cell response In the resting state, autoreactive T cells residing ... determining immunity or immune tolerance; this determination is based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen ... the induction of Foxp3+CD4+CD25+ T cells and for the suppression of CIIreactive T- cell function in induction of oral tolerance to CII These results demonstrate that the induction of IDO+ DCs in...

10
473
0

Báo cáo y học: "Phenotype and in vitro function of mature MDDC generated from cryopreserved PBMC of cancer patients are equivalent to those from healthy donors" ppt

Ngày tải lên : 11/08/2014, 10:23

... http://www.jibtherapies.com/content/5/1/7 maturation [17,18] The cytokine repertoire of DC matured in the presence of inflammatory stimuli comprises pro-inflammatory cytokines and chemokines, including the T cell inhibitory ... in the donor pool, MDDC from cancer patients are at least as functionally equivalent as those from healthy donors It is important to note that although the cancer patient cohort used in this study ... these reports could be related to the disease stage or the techniques used in culturing the DC or measuring the response It is of interest that MDDC from healthy donors in our study stimulated responses...

14
334
0

Báo cáo y học: " γδ T lymphocytes from cystic fibrosis patients and healthy donors are high TNF-α and IFN-γ-producers in response to Pseudomonas aeruginosa" pptx

Ngày tải lên : 13/08/2014, 13:20

... "in- vitro" producers of IFN-γ and TNF-α cytokines in response to P aeruginosa They contribute at the same extent as the predominant αβ subset to the percentage of cytokine-positive cells in total ... present results show that the percentage of γδ-positive cells in total T lymphocytes increases to the same extent in healthy and CF individuals after PBMC culture with PAc In both groups the expanded ... cytokine-producing αβ T cells (top) and γδ T cells (bottom) within total T lymphocytes after 10 days of culture with cytosolic extract from Pseudomonas aeruginosa, followed by hs restimulation with PMA-Io Intracytoplasmic...

14
202
0

Analysis, sequencing and in vitro expression of PCR products

Ngày tải lên : 25/10/2013, 22:20

... ● GAATTCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATA CATATG [1] ● CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTT CAAATACTTCCACCATG [2] could be used as 5′-extensions to primers to add a T7 RNA ... ATTCACTGGTATAGTACCAGTTCATGGCTGTGCTAGGTCCCGCTTGGAACACCGAACCCTTCTTCCATCCAAAGAGCCACGCGTGGTTG 10 20 30 40 50 60 70 80 (B) TCTGAACGGTACAATCCTTGCTTGTCAGCCGTCAACATTGGGTTGACCTTGGCATTGGGTAGGGACGTCCATGTCTTTGAAGAT ... GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT 260 270 280 290 300 310 320 330 TGGTCTTCTTGGCATCGTTGCCACCTGTTGACTACGATCTGACCGTTACCATCCATGGAGATACCAGGCCAGAACATA 340 330 360 370...

24
494
0

Tài liệu Báo cáo khoa học: "Reactive Content Selection in the Generation of Real-time Soccer Commentary" pdf

Ngày tải lên : 20/02/2014, 18:20

... candidates at translation time and it is the length of this template that decides the timing of the next content selection 5.2 Effect of Rearrangements Importance Score Increase Figure plots the ... place (the dotted line represents the importance score without interruption) The left part of the solid line is lower than the dotted, because the first utterance conveys less of its importance ... (information) when it is not completely uttered The right part of the dotted line is lower than that of the solid, because the importance of the second utterance decreases over time when waiting...

7
488
0

Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

Ngày tải lên : 07/03/2014, 06:20

... band spacing appeared to reﬂect the triplet repeat unit, implying that the in vitro DNA strand slippage syntheses of (AAT)3 ⁄ (ATT)5 and (ATT)3 ⁄ (AAT)5 tracts mainly occurred by triplet step expansion ... different to that of the bulge DNA host The addition of DDI-1A and DDI-1B to the two-base bulge (HT3AGTT) and three-base bulge (HT3AATTT and HT3AAATT) caused the DNA spectrum to be altered signiﬁcantly ... hairpin formation on the AAT strand of an AAT ⁄ ATT repeat tract, replication extends the foreshortened AAT strand The AAT bulge ⁄ hairpin may then come apart to allow the complementary ATT strand...

12
473
0

Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

Ngày tải lên : 07/03/2014, 15:20

... example, the extent of BrdU incorporation into cells treated with CDO alone and into cells treated with VP16 alone was summed, and compared to the extent of BrdU incorporation into cells treated with ... cells treated with the two individually) Cell growth arrest is protracted The extent of treatment-induced growth-arrest was investigated in GEO cells only, as inhibition of cell proliferation ... loss of CDK function, and the generation of cells with senescence characteristics In the ﬁrst part of the investigation, we determined the effect of continuous exposure to CDO on cell viability...

9
331
0

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

Ngày tải lên : 15/03/2014, 04:20

... incorporated into the database the best performing species that match the original criteria determined in the initial stages of the project can be selected These can then become the basis of a traditional ... Heat two batches of saline to 56◦ C and maintain at that temperature Collect and cut open gut sample, empty contents into 10 L bucket containing L saline kept at 39◦ C, wash gut surface in further ... exposure to plant material 3 In Vitro Methods for Direct Activity Against Ruminant Gastrointestinal Nematodes 33 In Vitro Screening A number of different bioassays using either the pre-parasitic stages...

252
4.5K
0