in vitro analysis of tdrl 505 8a wild type rpa purification sds gel rpa was purified as described in section 2 2 4 the lanes represent as follows 1 low molecular weight marker 2 whole cell extract 3 pooled fractions blue sephar
Báo cáo sinh học: " In vitro permissivity of bovine cells for wild-type and vaccinal myxoma virus strain" pot
Ngày tải lên :
18/06/2014, 18:20
... m.o.i of non infected resting 800 600 40 0 20 0 36 .7 % 0 20 0 40 0 600 800 10 00 1 .44 % 15 0 3. 42 % 15 0 10 0 10 0 50 50 cell count 10 3 1 02 10 1 10 0 10 0 10 1 1 02 10 3 10 0 1 04 10 1 1 02 10 3 10 20 0 20 0 93 % 20 0 40 0 ... 10 0 10 1 1 02 10 3 10 0 1 04 10 1 1 02 10 GFP fluorescence intensity 10 10 0 10 1 1 02 10 3 10 GFP fluorescence intensity B C 1, 00E+08 T1-Serp2-GFP 1, 00E+07 Log(virus titer) (pfu/ml) % of GFP positive cells ... 1, 00E+05 1, 00E+ 04 1, 00E+ 03 1, 00E+ 02 1, 00E+ 01 1,00E+00 1, 00E+08 1, 00E+07 1, 00E+06 1, 00E+05 1, 00E+ 04 1, 00E+ 03 1, 00E+ 02 1, 00E+ 01 1,00E+00 titration of each cell lysate on permissive rabbit RK 13 cells...
- 5
- 469
- 0
Báo cáo hóa học: " In vitro permissivity of bovine cells for wild-type and vaccinal myxoma virus strains" potx
Ngày tải lên :
20/06/2014, 01:20
... m.o.i of non infected resting 800 600 40 0 20 0 36 .7 % 0 20 0 40 0 600 800 10 00 1 .44 % 15 0 3. 42 % 15 0 10 0 10 0 50 50 cell count 10 3 1 02 10 1 10 0 10 0 10 1 1 02 10 3 10 0 1 04 10 1 1 02 10 3 10 20 0 20 0 93 % 20 0 40 0 ... 10 0 10 1 1 02 10 3 10 0 1 04 10 1 1 02 10 GFP fluorescence intensity 10 10 0 10 1 1 02 10 3 10 GFP fluorescence intensity B C 1, 00E+08 T1-Serp2-GFP 1, 00E+07 Log(virus titer) (pfu/ml) % of GFP positive cells ... 1, 00E+05 1, 00E+ 04 1, 00E+ 03 1, 00E+ 02 1, 00E+ 01 1,00E+00 1, 00E+08 1, 00E+07 1, 00E+06 1, 00E+05 1, 00E+ 04 1, 00E+ 03 1, 00E+ 02 1, 00E+ 01 1,00E+00 titration of each cell lysate on permissive rabbit RK 13 cells...
- 5
- 597
- 0
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc
Ngày tải lên :
17/03/2014, 10:20
... LE19A-8G LE19T-2C LE19C+2T LE19T+5A LE19A+8G 4. 10 1. 00
- 12
- 483
- 0
báo cáo khoa học: " In vitro analysis of the cytotoxicity and the antimicrobial effect of four endodontic sealers" ppt
Ngày tải lên :
11/08/2014, 20:21
... canal infection Int Endod J 20 06, 39 : 34 3 -35 6 35 Oguntebi BR: Dentine tubule infection and endodontic therapy implications Int Endod J 19 94, 27 : 21 8 -22 2 36 Tronstad L, Andreasen JO, Hasselgren G, ... 20 09, 20 :10 7 -11 1 Baer J, Maki JS: In vitro evaluation of the antimicrobial effect of three endodontic sealers mixed with amoxicillin J Endod 20 10 , 36 :11 70 -11 73 Siqueira JF Jr, Rôcas IN: Clinical ... that they have no competing interests 26 Received: 21 April 20 11 Accepted: 10 August 20 11 Published: 10 August 20 11 27 References Friedman S, Mor C: The success of endodontic therapy-healing and...
- 9
- 332
- 0
Báo cáo khoa học: " In vitro analysis of expression vectors for DNA vaccination of horses: the effect of a Kozak sequence" docx
Ngày tải lên :
12/08/2014, 18:22
... G1 H1 H2 W1 W2 V1 V2 B: lung cells kd C G1 H1 H2 W1 W2 V1 V2 10 0 75 HSA 55 40 33 b-gal 24 C: kidney cells kd C G1 H1 H2 D: W1 W2 V1 V2 10 0 75 duodenal cells kd C G1 H1 H2 W1 W2 V1 V2 HSA 55 40 ... citation purposes) Acta Veterinaria Scandinavica 20 08, 50 :44 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 http://www.actavetscand.com/content/50 /1 /44 Foecking MK, Hofstetter H: Powerful and ... http://www.actavetscand.com/content/50 /1 /44 2. 3 Transfection The expression of HSA was tested by transfection of COS7 cells using Lipofectamine 20 00 (Invitrogen) following the protocol recommended by the manufacturer Briefly the cells...
- 7
- 379
- 0
Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx
Ngày tải lên :
13/08/2014, 11:22
... points ( 24 , 48 , and 72 hours) Twenty-four hours after injury, CIs in group A were 4. 0 ± 1 .4 L/minute/m2 versus 3 .2 ± 1. 9 L/minute/m2 in group B At 48 hours, the CIs were 3. 8 ± 1. 5 L/minute/m2 in ... iliaca int rupture rs, scapula # 41 10 34 Male 2, 809 2. 6 Survived 22 Lung contus bs, L2 compression #, L3 L4 #, retroperiton hemat., acetabulum #, sacrum # 34 15 33 Male 2, 6 21 2. 6 Survived 23 Lung ... 48 11 49 Male 3, 089 11 2. 1 † (46 days) 26 Serial rib #, hemo-pneumoth., lung contus bs, amputation below knee rs, femur # 33 14 32 Male 3, 785 12 2 .1 † (11 days) Group A consisted of patients with...
- 8
- 291
- 0
Báo cáo y học: "Diagnostic value of real-time polymerase chain reaction to detect viruses in young children admitted to the paediatric intensive care unit with lower respiratory tract infection" pptx
Ngày tải lên :
12/08/2014, 23:23
... (n = 21 ) Immunofluorescence (n = 22 ) Real-time PCR (n = 23 ) RSV A/B 16 (9) Influenzavirus A/B (1) Rhinoviruses Adenoviruses (2) Coronavirus OC 43, 22 9E, NL 63 (1) hMPV (1) PIV 1/ 3 0 PIV 2/ 4 0 Chlamydia ... Virol 20 01, 21 :9 -16 27 Ison MG, Hayden FG, Kaiser L, Corey L, Boeckh M: Rhinovirus infections in hematopoietic stem cell transplant recipients with pneumonia Clin Infect Dis 20 03, 36 :11 39 -1 14 3 Available ... human coronavirus Nat Med 20 04, 10 :36 8 -37 3 32 Bakaletz LO: Viral potentiation of bacterial superinfection of the respiratory tract Trends Microbiol 19 95, 3 :11 0 -1 14 Page of (page number not for...
- 7
- 539
- 0
Báo cáo y học: " Functional analysis of human T lymphotropic virus type 2 Tax proteins" pptx
Ngày tải lên :
13/08/2014, 09:21
... M 22 (S 130 A/L 131 F) M47 (I 31 9 R/L 32 0 S) 10 0% 10 5% < 5% 10 0% 11 0% < 5% 10 0% < 10 % 13 0% 10 0% < 5% 11 5% LTR NFkB None G21D/L87I/P92L/T204A/W 248 R/L308V L87I/P92L/T204A/W 248 R/L308V P92L/T204A/W 248 R/L308V ... Y 14 4 C W 248 R 10 0% 14 % < 5% 13 % < 5% < 5% 30 0% 10 % 75% 24 6% 10 0% 55% < 5% 10 0% 14 0 % 12 5 % 12 0 % < 5% < 5% 16 8% < 5% 80% 19 5% 10 0% 36 % < 5% 2B Mo 2B Tax LTR NFkB None G21D L87I P92L Y 14 4 C Y 14 4 R A204T ... Page of 10 (page number not for citation purposes) Retrovirology 20 06, 3 :20 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 dependent upon a nuclear localization determinant in the Nterminal...
- 10
- 276
- 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx
Ngày tải lên :
22/06/2014, 22:20
... 0. 535 ◦ rms 3 .2- 3. 3 GHz 4. 1 -4. 3 GHz 10 0 11 0 0 .44 rms 0.50◦ rms − 12 0 13 0 − 14 0 15 0 16 0 0 .1 Table 3: Summary of synthesizer performance Parameter 10 10 0 Frequency offset (kHz) 10 00 10 000 Figure ... power, the doublesideband phase noise PSD is obtained as SΦ (z) = SΩ (z) = = (2 )2 − z 1 fr2 (2 )2 · − z 1 − z 1 fr2 12 (2 )2 · − z 1 12 fr 2m 2 2m fr (22 ) , where the subscript Φ denotes phase ... μm CMOS 11 5 − 92 0.8◦ rms kHz 10 MHz [ 14 ] 5 .1 5 .3 0 .18 μm CMOS 11 0 − 92 1. 5 ∼ 2 rms 10 kHz 10 MHz 2. 4, 5 .1 5 .3 0.5 μm BiCMOS − 12 0 −98 0 .4 rms, 2. 4 GHz 0.7◦ rms, 5 .3 GHz 10 0 Hz 10 MHz This work...
- 11
- 416
- 0
the american practical navigator table 1 logarithms of numbers
Ngày tải lên :
09/05/2016, 08:52
... 14 14 14 14 14 14 14 14 13 14 14 14 14 13 13 14 14 14 14 13 13 13 13 14 13 13 13 13 12 13 13 12 13 12 12 14 14 15 14 14 14 14 14 14 14 14 14 14 14 13 13 14 14 13 13 13 13 13 13 13 13 13 13 13 ... 14 14 14 14 14 14 13 14 13 14 14 14 13 14 14 13 13 13 13 13 13 13 13 13 13 12 12 13 13 13 13 13 13 14 14 14 15 14 14 14 14 14 14 14 14 13 14 13 13 13 14 13 13 13 13 13 13 13 13 13 13 13 13 13 ... 14 13 13 14 13 13 13 14 13 13 13 13 13 13 13 13 13 13 12 13 12 12 12 14 14 14 14 15 14 14 14 14 14 14 14 14 13 14 13 14 14 13 13 13 13 13 13 13 13 13 13 13 13 12 13 13 13 13 13 13 13 15 15 14 ...
- 10
- 218
- 0
3 2 4 the magic of coyote
Ngày tải lên :
20/04/2017, 15:46
... Foresman, 19 00 East Lake Avenue, Glenview, Illinois 60 025 10 V0G1 14 13 12 11 10 09 08 07 06 05 Henry’s stomach turned as he thought of his fear of dogs, and he could barely eat his breakfast! His mother’s ... sharp teeth and unpleasant smells If he had his way, he would never see another dog for the rest of his life! He was terribly afraid of them Photograph 24 DK Images ISBN: 0- 32 8 - 13 34 8 -5 Copyright © ... Tommy waved to him as he stepped aboard Tommy was nine, the same age as Henry He was tall and thin and had dark black hair, and he was a chatterbox He was interested in everything, and he liked...
- 14
- 253
- 0
Analysis, sequencing and in vitro expression of PCR products
Ngày tải lên :
25/10/2013, 22:20
... TCTGAACGGTACAATCCTTGCTTGTCAGCCGTCAACATTGGGTTGACCTTGGCATTGGGTAGGGACGTCCATGTCTTTGAAGAT 90 10 0 11 0 12 0 13 0 14 0 15 0 16 0 17 0 TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 18 0 19 0 20 0 21 0 22 0 23 0 24 0 25 0 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT ... GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT 26 0 27 0 28 0 29 0 30 0 31 0 32 0 33 0 TGGTCTTCTTGGCATCGTTGCCACCTGTTGACTACGATCTGACCGTTACCATCCATGGAGATACCAGGCCAGAACATA 34 0 33 0 36 0 37 0 38 0 39 0 40 0 41 0 Figure 5.6 Direct sequencing of PCR products ... 10 7 14 15 16 17 18 19 20 21 22 23 24 DNA sequencing of allele-specific polymerase chain reaction-amplified HLA-DR genes BioTechniques 10 : 30 Stahl S, Hultman T, Olsson A, Moks T, Uhlen M (19 88)...
- 24
- 494
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
Ngày tải lên :
07/03/2014, 21:20
... of the thylakoid, or that they are shielded from trypsin digestion on the cis-side of the membrane The A B 40 04 Fig Determination of the topology of PSI-G in the thylakoid membrane using in vitro ... individual plant, placed in an Eppendorf tube and frozen in liquid nitrogen Frozen tissue was pulverized in 20 0 lL protein extraction buffer [PEB: 10 0 mm FEBS Journal 27 2 (20 05) 40 02 40 10 ª 20 05 ... Biophys Acta 17 08, 1 54 16 3 Jensen PE, Rosgaard L, Knoetzel J & Scheller HV (20 02) Photosystem I activity is increased in the absence of the PSI-G J Biol Chem 27 7, 27 89 28 03 Jensen PE, Gilpin M, Knoetzel...
- 9
- 422
- 0
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
Ngày tải lên :
16/03/2014, 11:20
... [ -33 P]-ATP bound A 0 20 40 60 80 10 0 B 12 0 20 40 60 Time (min) 10 0 C 60 40 D 60 40 0 20 40 60 22 10 12 14 16 12 14 16 [ GST - IB ] ( àM) 20 E 20 [ATP] (àM) F 18 16 14 12 10 16 14 nM min -1 Initial ... (ngãmL1) 5 .1 2. 3 4. 9 4. 7 2. 1 4. 5 1. 9 4. 3 1. 7 4. 1 1.5 50 10 0 15 0 20 0 25 0 30 0 35 0 40 0 45 0 Time (min) 50 10 0 15 0 20 0 25 0 30 0 35 0 40 0 45 0 Time (min) Fig Immunocytochemical staining of A 549 cells and analysis ... were 2. 3 0.6 lM, 3. 7 0.9 lM, 1. 51 ã 10 )3 s )1 and 18 .7 nMặmin )1, respectively, in kinase buffer Tris HCl MgCl2 MnCl2 and 2. 5 1 .2 lM, 6 .1 1. 3 lM, 2. 15 ã 10 )3 s )1 and 16 .2 nMặmin )1 in kinase...
- 13
- 475
- 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx
Ngày tải lên :
22/03/2014, 21:20
... 12 12 12 – – – 51 51 51 – – – – 51 – 51 51 32 20 26 – 14 14 14 – – 20 26 24 – – – 24 24 24 24 24 – 24 12 – – – 12 12 12 – – – 12 24 – 24 – 24 24 24 24 24 – – 12 – 12 – 12 12 12 – – – – Yes No ... indicate reversible reactions 1 026 Core Side ATP NADPH Lipid A Lipid A (ca) Cardiolipin L1-P-EtAmine 24 51 24 24 12 32 12 12 36 – 42 38 44 28 – 32 14 16 54 57 52 25 FEBS Journal 27 7 (20 10 ) 1 0 23 10 34 ... compilation ª 20 10 FEBS 10 33 Theoretical study of lipid biosynthesis in E coli 41 42 43 44 45 46 47 48 49 50 51 52 D Kenanov et al aspects of functionality and regulation Nature 42 0 , 19 0 19 3 Edwards...
- 12
- 553
- 0
Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx
Ngày tải lên :
20/06/2014, 02:20
... 31 3 plasma 31 3 -I 31 3 -T1 60 26 26 09 /27 /20 04b 9 /27 /20 04 10 /10 /20 04c 10 /10 /20 04 10 /18 /20 04 10 /18 /20 04 21 21 23 8 plasma 23 8-T1 25 26 08 /30 /20 02b 09/ 01 /20 02c 8 /30 /20 02 2 / 24 /20 05 909 0 81 serum 0 81- T1 ... 10 / 02/ 2001c 3 /16 /20 01 2/ 24 /20 05 4 / 24 /20 05 9 /11 /20 01 7 / 21 /20 01 9/ 14 /20 01 10/ 12 / 20 01 2/ 4 /20 05 10 /10 /20 01 14 4 1 1500 17 9 12 7 1 82 210 1 42 1 20 8 a Samples from sera and isolates were cloned and sequenced The ... 0 81- T1 11 2B-T1 11 2A-T1 11 2AB-T1 PCLB-T1 PCLB-T4a PCLB-T4b PCLB-T7 26 25 27 25 26 26 25 26 25 03 /16 /20 01b 04/ 08 /20 01c 04/ 08 /20 01c 04/ 08 /20 01c 04/ 08 /20 01c 04/ 08 /20 01c 08/08 /20 01c 08/08 /20 01c 10 / 02/ 2001c...
- 15
- 340
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
Ngày tải lên :
21/06/2014, 02:20
... 1. 12 2.09 ± 0.80 Kidneys 13 . 13 ± 2. 34 8 .27 ± 0. 84 6.00 ± 1. 57 5 .22 ± 0. 94 2. 66 ± 0 .46 Lung 4. 40 ± 1. 14 2. 23 ± 0 .39 1. 79 ± 0. 31 1.06 ± 0 . 21 0.8 ± 0 .26 Heart 3. 57 ± 1. 11 2. 06 ± 0 . 23 1. 86 ± 0 .30 1 .20 ... 0. 02 Tumor Liver 21 . 42 ± 7.67 8. 01 ± 1. 63 21 . 12 ± 2. 85 4. 98 ± 0.98 21 .55 ± 6 .2 4. 66 ± 0. 62 16 .55 ± 2. 35 3. 55 ± 0. 62 8. 01 ± 3. 65 3. 38 ± 0.67 Spleen 5 . 43 ± 1. 64 3. 61 ± 0.87 3. 96 ± 1. 19 2. 63 ± 1. 12 ... distribution of i v injected mice bearing s.c LS -17 4T xenografts 11 1 In- CHX-A"-panitumumab F(ab’ )2 in athymic Time points (h) Tissue 24 48 72 96 16 8 Blood 6. 84 ± 2. 30 2. 28 ± 0. 53 1. 12 ± 0 .27 0. 32 ± 0 .12 ...
- 15
- 452
- 0
Báo cáo khoa học: "Cold storage of in vitro cultures of wild chestnut and oak" pdf
Ngày tải lên :
08/08/2014, 19:21
... growth of the shoots, independently of the time of storage As the storage time increased, the growth of the shoots increased in the first subculture after storage, although this effect was not ... burg 1 64, 13 7- 14 4 Millar Cl (19 93) Conservation of germplasm in forest trees In: Clonal Forestry II (MR Ahuja, WJ Libby, eds), Springer-Verlag, Heidelberg, Germany, 42 - 65 Murashige T, Skoog F (19 62) ... the of cold storage of in vitro cultures: the physiological state of shoots, the type of explant, the medium, the container, the temperature and the light conditions (Orlikowska, 19 92) Meier-Dinkel...
- 7
- 253
- 0
Báo cáo y học: "In vitro model for the analysis of synovial fibroblast-mediated degradation of intact cartilage" pptx
Ngày tải lên :
09/08/2014, 01:22
... for citation purposes) 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 protects cartilage collagen from proteolytic cleavage J Biol Chem 20 03, 27 8 :45 539 -45 545 Dickinson SC, Vankemmelbeke ... protease gene expression and joint erosions in early rheumatoid arthritis Arthritis Rheum 20 01, 44 :1 744 -17 53 Matrisian LM: The matrix-degrading metalloproteinases Bioessays 19 92, 14 : 455 -46 3 Murphy ... and 10 -fold, respectively, for MMP -1; 11 -, 21 and 24 -fold for MMP -3; Figures 11 e, f) Expression of pro-inflammatory cytokines The influence of the pro-inflammatory cytokines TNF-α and IL1β on the...
- 20
- 524
- 0
Báo cáo lâm nghiệp: "Internal levels of plant growth regulators during in vitro culture of wild cherry (Prunus avium L.)" doc
Ngày tải lên :
09/08/2014, 04:20
... L.M.S (19 83) The biosynthesis and metabolism of cytokinins Annu Rev Plant Physiol 34 , 16 3 -19 7 Maldiney R., Leroux B., Sabbagh L, Sotta B., Sossountzov L & Miginiac E (19 86) A bio- tin-avidin-based ... levels of abscisic acid, indole -3- acetic acid and benzyladenine during in vitro bud growth induction of wild cherry (Prunus avium L.) Plant Growth Regul 8, 32 5 -33 3 Leroux B., Maldiney R., Miginiac ... Sotta B (19 85) Comparative quantitation of abscisic acid in plant extracts by gas-liquid chromatography and an enzymelinked immunosorbent assay using the avidin-biotin system Planta 16 6, 5 24 - 529 Letham...
- 4
- 324
- 0