in the leaves of eugenia florida by using the technique gc ms gc fid and hplc dad a seasonal and quantitative study

A study of politeness strategies in requests in the course book ''streamline english departures and connections'' by b hartley & p viney

A study of politeness strategies in requests in the course book ''streamline english departures and connections'' by b hartley & p viney

Ngày tải lên : 14/12/2013, 00:41
... the hearer and the speaker; the social distance between the hearer and the speaker, and the ranking of the imposition involve in doing the face threatening act In requesting, some factors plays ... strategies In everyday interaction, people always adapt them to different situations and tend to maintain one anothers face continuously They try to avoid causing damage to each other and therefore, ... are the basic wants in any social interaction, and so during any social interaction, cooperation; cooperation is needed among the participants to maintain each others faces 1.3.4.2 Face-threatening...
  • 68
  • 716
  • 6
Tài liệu Báo cáo " Research on the optimal picket sampling interval in automated digital terrain model creation by using digital photogrammetry " ppt

Tài liệu Báo cáo " Research on the optimal picket sampling interval in automated digital terrain model creation by using digital photogrammetry " ppt

Ngày tải lên : 13/02/2014, 12:20
... number of cells inside the interested area The above calculation can easily be done by using Raster Calculator tool of ArcGIS software For the sake of convenience, the squares of ∆ i are also calculated ... measurement There are at least ground control points in each of photostrips (4 at the corners and in the center) The coordinates of control points are obtained by measuring GPS baselines to at least points ... Photoscanning Project assembling is used for creating and testing DTMs Since the main purpose of the research is to assess the quality of automated picket sampling and measuring, some steps (additional...
  • 9
  • 462
  • 1
The Future of Organization’s Computer Network Security for the Next 5 Years (2011-2015) by Using Delphi Technique doc

The Future of Organization’s Computer Network Security for the Next 5 Years (2011-2015) by Using Delphi Technique doc

Ngày tải lên : 05/03/2014, 23:20
... organization’s network [10] stated that the one thing most valuable to the organization is data or information, so protecting the data or information is very important and necessary in the information ... computer systems and network play an important role in everyday life; using the database via a network or via the web browser or accessing to various information systems via the corporate network ... questionnaire but adding the value of the median and ranges between the quartile The purpose of this is to have the experts group compare and confirm their opinions in the second round questionnaire The...
  • 5
  • 550
  • 0
Báo cáo Y học: Production and chemiluminescent free radical reactions of glyoxal in lipid peroxidation of linoleic acid by the ligninolytic enzyme, manganese peroxidase pot

Báo cáo Y học: Production and chemiluminescent free radical reactions of glyoxal in lipid peroxidation of linoleic acid by the ligninolytic enzyme, manganese peroxidase pot

Ngày tải lên : 24/03/2014, 04:21
... 1-dodecanal was added instead of linoleic acid (E) As (A) but 1-hexanal was added instead of linoleic acid (F) As (A) but 2,4-nonadienal was added instead of linoleic acid (G) As (A) but MDA was added ... (A) but trans-2-nonenal was added instead of linoleic acid (D) As (A) but 1-dodecanal was added instead of linoleic acid (E) As (A) but 1-hexanal was added instead of linoleic acid (F) As (A) ... of linoleic acid (D) As (A) but 1-dodecanal was added instead of linoleic acid (E) As (A) but 1-hexanal was added instead of linoleic acid (F) As (A) but 2,4-nonadienal was added instead of linoleic...
  • 9
  • 459
  • 0
synthesis of inorganic nanowires by using peptide nanotubes as the templates via biologic recognition

synthesis of inorganic nanowires by using peptide nanotubes as the templates via biologic recognition

Ngày tải lên : 13/11/2014, 16:27
... biology in the synthesis and assembly of significant nanomaterials and nanodevices 1.2 Nanoparticles The development of nanomaterials, such as nanowires, nanotubes and nanoparticles is a fundamental ... corresponding electrochemical half-reaction Since the E E values of all reactions are stated relative to that of H2, the half-reaction and for H2 are, by definition, at standard temperature and pressure ... metals, there is a gap between the valence band and the conduction band in nanoparticles This size-induced metal-insulator transition was first described in 1988 as the metal particle was small...
  • 132
  • 416
  • 0
Improving the corrosion resistance of buried steel by using

Improving the corrosion resistance of buried steel by using

Ngày tải lên : 27/04/2015, 09:06
... survey of the sample, and the rest of the elements In addition to the carbon, N, O, and Fe elements were scanned and the area under each element peak was calculated The scan area was mm × mm and the ... were a crucial factor for determining the protective performances of the coatings El-Shazly and Wazan[14] found that the corrosion rate of the galvanic coupling of PANi coated steel and zinc has ... data are the average of 50 scans of each element analysed The surface composition in atomic percentage was calculated using the element relative cross sectional area as supplied by the XPS manufacturer...
  • 11
  • 284
  • 0
Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH

Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH

Ngày tải lên : 04/10/2015, 16:03
... AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG SMRT -A GeneID 20602 GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA GGGGGGTATCTTAGTTTCGTGGAAGTTCTCTCCACGAAACTAAGATACCCAAAAATTCGA SMRT-B GeneID 20602 GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA ... GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA AGCTTAAAAATGACTACATCACCTCGCAGTCTCTTGAACTGCGAGGTGATGTAGTCAGGG Table 2: Oligonucleotides designed for synthesis of siRNA 2.2.2.2 Annealing of ... β-actin gene I β-actin gene II Sequence (5’-3’) GCCTGTCAACGCAACTCTGG CAGGCCATTGGTTGAGTCCT AGCACTGACTGCACCGTGAG CCTCAGCCAGCTTCATCAGC GCCATGTACGTAGCCATCCA Primer size (bp) 20 20 20 20 20 20 Amplicon...
  • 94
  • 284
  • 0
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens

Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens

Ngày tải lên : 05/09/2013, 08:40
... nitroarenes, aromatic amines and heterocyclic amines In addition, free radicals may be the most important genotoxic agents contributing to age-related diseases including cancer, and produce various ... chemicals) (12 Fig Relationship between mutagenicity in YG3003 and 8-OH-Gua level in rat hepatocytes induced by chemicals Fig Chemicals tested are Aflatoxin B1, 2-aminoanthracene, 2-aminoanthraquinone, ... inorganic chemicals and natural toxins, etc These results may suggest that the utility and limitations of both the Ames test and 8-OHGua assay in detecting chemicals likely to be environmental...
  • 6
  • 735
  • 0
Regulation of navigation and vessel-source pollution in the Northern Sea Route - Article 234 and state practice

Regulation of navigation and vessel-source pollution in the Northern Sea Route - Article 234 and state practice

Ngày tải lên : 01/11/2013, 09:20
... inconsistencies and differing approaches, Russia, the USA and Canada seem to have – individually – established remarkably similar standards applicable in their Arctic EEZs, or substantial parts thereof Thus, ... in the west are the western entrances to the Novaya Zemlya straits and the meridian running from Mys Zhelaniya northward, and in the east, in the Bering Strait, by the parallel 66° N and the ... regarding those in the Russian and Canadian Arctic.15 In the US view, the Russian Arctic straits are international and thus subject to transit passage.16 In addition, US declarations have included...
  • 23
  • 555
  • 0
Luận văn english prepositions of place at, on, in an analysis of errors made by secondary school students

Luận văn english prepositions of place at, on, in an analysis of errors made by secondary school students

Ngày tải lên : 20/12/2013, 18:17
... There's a drop of paint on the window in the window/mirror I see my face in the window on the island in the island Robinson Crusoe was marooned on an inhabited island He was born in Long Island on the ... the first language in Great Britain, the United States, Australia, etc and is the second or foreign language in the rest of the world It is preferred as the official language in many organizations ... it happens continuously regardless of the need of a formal and standard English Is it doubtful that the difficulty and errors in acquiring and using prepositions of place AT, ON, IN of Vietnamese...
  • 46
  • 1.4K
  • 18
Tài liệu Báo cáo " Deodorization of food wastewater by using strong oxidants " pdf

Tài liệu Báo cáo " Deodorization of food wastewater by using strong oxidants " pdf

Ngày tải lên : 12/02/2014, 17:20
... Concentration of CaO was varied in range of 3.2 to 4.8 g/l with 0.25 g/l of CaOCl2 added The effect of concentration of CaO to the odor of wastewater was shown in Table When the concentration of CaO ... [13], wastewater was added 0.4 g/l and 0.25 g/l of CaO and CaOCl2 respectively After certain time of treatment, effluent was taken out and removed precipitate before measuring other factors Treatment ... CaOCl2 and g/l of CaO is the best condition for treatment of litre wastewater After treatment by oxidants, wastewater was settle and drained directly to the sewage without any treatment 32 L.D Manh...
  • 6
  • 373
  • 0
Báo cáo khoa học: Photoregulation of DNA transcription by using photoresponsive T7 promoters and clarification of its mechanism doc

Báo cáo khoa học: Photoregulation of DNA transcription by using photoresponsive T7 promoters and clarification of its mechanism doc

Ngày tải lên : 15/03/2014, 10:20
... difference in thermal stability of the cis form between Azo and DM-azo (A) Illustration of the reversible photoisomerization of Azo and thermal isomerization of cis-Azo (B) Quantitative calculation of ... trans–cis isomers, a solution containing ssDNA involving one Azo and one DM-azo was maintained at 90 °C for h after trans fi cis isomerization as described above Then, the template strand was added ... reaction (ATP incorporation rate) for (A) trans–trans and (B) cis–cis forms by T7 RNAP as a function of promoter concentration The concentration of RNAP was maintained at 150 nM for the trans–trans...
  • 11
  • 436
  • 0
Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

Ngày tải lên : 23/03/2014, 04:21
... interacting partners of the mutated residues are shown in yellow and the dipyrromethane (DPM) cofactor is shown in the ball and stick representation Magenta indicates the beginning and the end of ... 12.5% TCA as a blank The exact concentration was determined at room temperature by measuring A4 05 and calculated as A4 05 ⁄ e (e – 505 · 103 LÆcm)1Æ mol)1) A standard curve in the linear range of fluorescence ... three domains The catalytic active site cleft contains the dipyrromethane cofactor The active site is located between the N-terminal and central domains and the dipyrromethane cofactor is covalently...
  • 10
  • 587
  • 0
báo cáo sinh học:" Non-European Union doctors in the National Health Service: why, when and how do they come to the United Kingdom of Great Britain and Northern Ireland?" pdf

báo cáo sinh học:" Non-European Union doctors in the National Health Service: why, when and how do they come to the United Kingdom of Great Britain and Northern Ireland?" pdf

Ngày tải lên : 18/06/2014, 17:20
... Percentage of responses Year of primary medical qualification Figure Diagram1showing the year of primary qualification of overseas doctors Diagram showing the year of primary qualification of overseas ... doctors in the UK have been attracted by prospects of post-graduate training Changes to immigration policy that fail to factor in the aspirations and needs of doctors who have already migrated to the ... initial manuscript KSR and JA administered the survey GAM and EBJ reviewed the literature and edited the manuscript All authors read and approved the final manuscript References Goldacre MJ, Davidson...
  • 6
  • 534
  • 0
báo cáo hóa học: " Audio segmentation of broadcast news in the Albayzin-2010 evaluation: overview, results, and discussion" potx

báo cáo hóa học: " Audio segmentation of broadcast news in the Albayzin-2010 evaluation: overview, results, and discussion" potx

Ngày tải lên : 21/06/2014, 02:20
... project The database includes 24 files of approximately 4-h duration each, and a total duration of approximately 87 h of annotated audio a The manual annotation of the database was performed in two ... studies Taking into account the increasing interest in the problem of audio segmentation, on the one hand, and the existence, on the other hand, of a rich variety of feature Butko and Nadeu EURASIP ... every years Actually, the quantitative comparison and evaluation of competing approaches is very important in nearly every research and engineering problem The evaluation campaigns that independently...
  • 10
  • 484
  • 0
Báo cáo hóa học: " Research Article Classification of Hazelnut Kernels by Using Impact Acoustic Time-Frequency Patterns" pot

Báo cáo hóa học: " Research Article Classification of Hazelnut Kernels by Using Impact Acoustic Time-Frequency Patterns" pot

Ngày tải lên : 22/06/2014, 19:20
... features An LDA classifier is trained with these features and tested using data that was not used for training The main contribution of the proposed approach is the systematic and automatic extraction ... locations, and the parameters of a Weibull distribution approximation of the envelope of the impact signal parameters The same features were used for cracked and regular shell hazelnut separation and ... classification In the subbandbased algorithm [8], features were extracted from subband signals and the 20 most relevant features and the subbands including these features were manually selected The...
  • 11
  • 286
  • 0
Báo cáo khoa học: "Differences in the serum immunoglobulin concentrations between dairy and beef calves from birth to 14 days of age" pdf

Báo cáo khoa học: "Differences in the serum immunoglobulin concentrations between dairy and beef calves from birth to 14 days of age" pdf

Ngày tải lên : 07/08/2014, 17:22
... cow was moved into an individual calving pen (3.4 × 8.0 m) with straw bedding The Korean native calves were born between April and August 2000, and all the dams and their calves (8 heifers and ... became same at days and days of age, respectively but the mean IgG level of beef calves was approximately twice that of dairy calves until 14 days of age This could explain that Korean native cattle ... (VMRDTM Inc., Pullman, USA) [1] Data analysis The serum IgG, IgM and IgA concentrations at each sampling time for both dairy and beef calves were compared using Student’s t-test of SAS [21] Fig Changes...
  • 4
  • 428
  • 0
Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot

Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot

Ngày tải lên : 09/08/2014, 03:22
... - Tabulated data, wrote the manuscript in draft BED -Undertook all of the statistical analysis and contributed to several drafts of the paper RID Helped in data collection and tabulation and ... Conceived of the idea, participated in its design and wrote and supervised several drafts of the manuscript All authors have read and approve of the final manuscript Competing interests The authors ... comparable data were available (Table 1) Again, consecutive sampling as employed to avoid selection bias in the older age group, with the added inclusion criteria being age above 50 years and...
  • 11
  • 436
  • 0
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot

Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot

Ngày tải lên : 09/08/2014, 03:24
... whereas the affinity of the other ameliorating mAb, OX35, was comparable to that of the accelerating mAb, RIB5/2 On the other hand, a contribution of the strikingly higher kdiss of the mAb RIB5/2 ... according to the extent of erythema and edema of the periarticular tissue, on a scale of 04, where = no inflammation, = unequivocal inflammation of one paw joint, = unequivocal inflammation of at ... investigated For the sake of simplicity, we refer to the mAb RIB5/2 as accelerating (although this term is applicable only to the onset of AA) and the mAbs W3/25 and OX35 as ameliorating Affinity...
  • 14
  • 431
  • 0
Báo cáo khoa học: " Counting colonies of clonogenic assays by using densitometric software" pot

Báo cáo khoa học: " Counting colonies of clonogenic assays by using densitometric software" pot

Ngày tải lên : 09/08/2014, 10:21
... influence the inherent advantage of automated counting according to economy of time Additional material Additional File Clono-Counter Contains a manual for the program, the program itself and an example ... overall result The program is written in Java and can be downloaded It is freely available and we are interested in feedback and whether you can use the program for your practical work Detailed advice ... level, the maximum size of one colony (defined by the area) and another parameter that considers the distribution of the gray colour within the colony This is done by writing every cluster of the...
  • 3
  • 217
  • 0