0

in multimodular gene products the extracellular matrix glycoprotein tenascin c

Role of nitric oxide in wound healing facilitatory effects of nitrosoglutathione a nitric oxide donor on the extracellular matrix deposition characteristics of wound healing

Role of nitric oxide in wound healing facilitatory effects of nitrosoglutathione a nitric oxide donor on the extracellular matrix deposition characteristics of wound healing

Cao đẳng - Đại học

... local (i.e., paracrine) effects rather than circulating effects PDGF has mitogenic and chemotactic activity, on the target cells Many cells express receptors for PDGF, including some microvascular ... 1990) The appearance of the myofibroblasts corresponds to the commencement of connective tissue compaction and the contraction of the wound New collagen bundles in turn have the capacity to join ... enzymes or extracellular matrix components which coordinate wound healing The cells and their secreted products in turn affect the functioning of other cells through several signaling pathways,...
  • 258
  • 672
  • 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Báo cáo khoa học

... GTTGAAGCTTGTGTCTATTAATCTGACTGTA 87 85 83 80 74 TAGACCATGGTGGCTTATCCTCCAGTAATGC GTGTAAGCTTGAAGCAGAGAAGCAAGCAACTG ACTGCCATGGTGGCCTTCACTTTTGGTCCATTTAC TGGAAAGCTTGCCACATCAGTCTACAAAG TGCTCCATGGTGGCATCCCAATATGTAAACCA ... TGCTCCATGGTGGCATCCCAATATGTAAACCA GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA CAAAACATGTTGGCTACGGGACATACAAATGTTCA GTTGAAGCTTTTTGAAACTTAGCACTTCTGC ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC TCAAAAGCTTATGATTTCACGTTTAGCTC CTTTCCATGGTGGCTGTCACTATATTTTTTCA ... TAGGTACCAATACAGTAATATATG-3¢; P4, 5¢-TGC TAGATCTCCACCCACTCA-3¢; P5, 5¢-TTATGGTACC TGAAAGGGAATAGCGGC-3¢; P6, 5¢-GGCTGGTAC CCTTGCGCTCCGTC-3¢; P7, 5¢-GGAGAGATCTGCG GGAAGCCGCGACAGA-3¢; p8, 5¢-TTCCAGATCTG...
  • 16
  • 438
  • 0
Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx

Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx

Báo cáo khoa học

... of the MSP-1 gene) (5¢-TCC ATC ACC TCC ATT GCC TCC-3¢), corresponding to the amino acid sequences of the SGSSSSS and GGNGGDG of the MSP-1 gene, Total RNA was extracted with Isogen (Nippongene) ... on the organic matrix in molluscan shells-I Amino acid composition of the organic matrix in the nacreous and prismatic layers Venus 47, 127–140 24 Samata T (1990) Ca-binding glycoproteins in ... 1827) (5¢-TCT GGC ATG AAA CAC GAC AAC-3¢), based on the nucleotide sequences of the 5¢ and 3¢ terminal regions, respectively TA cloning cDNA cloning Tissue collection for RNA extraction The outer...
  • 13
  • 425
  • 0
Báo cáo y học:

Báo cáo y học: " Egr-1 inhibits the expression of extracellular matrix genes in chondrocytes by TNF-induced MEK/ERK signalling" ppsx

Báo cáo khoa học

... protein products were localized to the extracellular space determined that many of the protein products of these genes were involved in a variety of activities, including chemokine/cytokine activity ... MEK/ERK-dependent genes – whose products are found in the extracellular space – indicated that some of these genes were significantly categorized by the molecular function of their protein products into categories ... also induced by TNF in chondrocytes [36] In rat articular chondrocytes, macrophage Csf-1-induced signalling increases its own expression and the expression of the matricellular protein CCN2 (formerly...
  • 14
  • 574
  • 0
Báo cáo y học:

Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot

Báo cáo khoa học

... quantification of the transcriptomic interactions relating relevant biological themes and construction of functional interaction maps characterizing the transcriptomic signature of obese WAT in the ... ECM components or involved in inflammatory processes In agreement, human pre-adipocytes cultured in the presence of AcMCs increased their production of fibronectin and collagen type I, which formed ... Pancreatic cancer Chronic myeloid leukemia B cell receptor signaling pathway T cell receptor signaling pathway Glycosaminoglycan degradation Complement and coagulation cascades Glycan structures...
  • 32
  • 429
  • 0
Báo cáo y học:

Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps

Báo cáo khoa học

... 5'-GGA GCG CCG CCT GGA G-3' and reverse 5'-CCA TAT TCT TTC ACC GCC CAC TCC-3'; Invitrogen) Each PCR reaction contained μM of the respective forward and reverse primers, 1.5 mM MgCl2, 0.2 mM dNTPs ... since focal adhesion signaling, as defined in the KEGG database, can be activated by cytokine-cytokine receptor interaction, which is also the major activation method of the JAK-STAT pathway In ... (mutagenic) changes, such as characteristic translocations [12] and the presence of epigenetic control [44] We should also now be able to monitor the effects of novel therapeutics on the cancer stem cell...
  • 13
  • 682
  • 0
Tài liệu Committee on Toxicity of Chemicals in Food, Consumer Products and the Environment - Subgroup Report on the Lowermoor Water Pollution Incident pdf

Tài liệu Committee on Toxicity of Chemicals in Food, Consumer Products and the Environment - Subgroup Report on the Lowermoor Water Pollution Incident pdf

Điện - Điện tử

... by the World Health Organization In the case of chemical contaminants, the guidelines take the form of a maximum recommended concentration for a contaminant in drinking water In the case of acidity, ... However, the study found that the pollution incident did not cause an increased incidence of infection 1.30 There was no indication from the toxicological data on the contaminants of an adverse effect ... piping within the house In such properties the acidic water could have dissolved lead from the pipes, leading to increased concentrations in the water in the domestic system 3.18 Flushing of the...
  • 448
  • 3,742
  • 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Báo cáo khoa học

... Syk in K562 cells (A) K562 cells stably expressing FcR c- chain (pRc /c) , or cotransfected with either wild-type GPVI and FcR c- chain (F1 /c) or a cytoplasmic-taildeleted GPVI and FcR c- chain (C1 /c) ... association with FcR c- chain Fig FcR c- chain and the cytoplasmic tail of GPVI are necessary to initiate the GPVI signalling cascade (A) K562 cells stably transfected with FcR c- chain and cotransfected ... erythroleukaemic cell line K562, which 2954 O Berlanga et al (Eur J Biochem 269) Fig Convulxin colocalizes at the membrane with the chimeric protein GPVI–GFP in the absence of FcR c- chain COS-7 cells growing...
  • 10
  • 506
  • 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Báo cáo khoa học

... Mut10 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ... ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ... corepressor Complex by the receptor, which then recruits a series of coactivator proteins, such as steroid receptor coactivator (SRC-1), glucocorticoid receptor interacting protein (GRIP1), activator...
  • 12
  • 399
  • 0
Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

Báo cáo khoa học

... to the thin black line; the calculated concentration control coecient is shown as a thick black line The dCTP pool size in the reference strain CJ233 is shown by a stippled line decrease in the ... promoter promoter integrated integrated integrated integrated integrated integrated integrated integrated integrated integrated integrated integrated in in in in in in in in in in in in attB attB ... starved for CTP by resuspending cells in medium lacking cytidine thereby reducing the CTP pool size This results in accumulation of phosphatidic acid, the substrate for CDP-diacylglycerol synthetase...
  • 8
  • 489
  • 0
Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học

... viruses, which are the main cause of various cancers, including cervical carcinoma In vitro data backed by recent in vivo studies suggest the existence of an elaborate sequence of cell surface events ... neither accessible in capsids nor in capsomeres [71] It remains unclear whether this antibody recognizes a speci c step in uncoating or reacts with protein in the lysosomal compartment in the ... intercapsomeric cleft to which the invading C- terminal arm contributes [15], suggesting that elements located within the cleft contribute to cell binding It is hoped that the determination of the...
  • 11
  • 511
  • 0
Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx

Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx

Báo cáo khoa học

... differentiation factor (GDF) (a 1299-bp fragment with sense primer: 5¢-GCAAGAGCAGGCA CCCAGCAACCAG-3¢ and antisense primer: 5¢-TTCCGT CACATAAAACCACAGCACT-3¢), follicle stimulating hormone (FSH) receptor ... 5¢-GAATCAAAGCCATACTGT-3¢), and vascular endothelial growth factor (VEGF) (a 612-bp fragment with sense primer: 5¢-TCAAGCCGTCCTGTG TGCCGCTGATGC-3¢ and antisense primer: 5¢-AGAAA ATGGCGAATCCAGTCCCACGAG-3¢) ... primer:CGTAAGGC TGTCTCTCATCAAAACT-3¢), bone morphogenetic protein (BMP) 15 (a 1057-bp fragment with sense primer: 5¢-CCCTGGCAAGGAGATGAAGCAATGG-3¢ and antisense primer: 5¢-GGGAAACCTGAGATAGCAACA ACTT-3¢),...
  • 9
  • 404
  • 0
Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học

... one of the products of the reaction used to represent the cell cycle in each of the cells In this case, the attractor used to represent each cell was the Rossler attractor and each cell ran the ... Viewing continuous cultures of yeast as a stochastic tissue The details of the cellular dynamics that lead to the emergence of redox and TRAC oscillations and the gating of cells into cell-cycle ... formed the experimental foundation of efforts to synthesize a model of the cell cycle in which such disparate concepts as check points, and limit cycles or complex attractors were fused The basic...
  • 13
  • 238
  • 0
báo cáo hóa học:

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

Hóa học - Dầu khí

... ATCAGGTCAGGTCAGCCATT TGCACGAGTCACACTGGAGC ATGCCGAATTCCTGGTCTGG GCAGAAGTCAACCAGACCGA GCAAGTATCCGCAGACGCTC AACGGCAAGATGCACATCAC ATATAGCACGGGATCATGGG GCTATGCTGGCTACCAGATG ATCAGCCTGCAGCACCAGAG ACACTCTACCACTGGCATCC ... ACACTCTACCACTGGCATCC GCTACTTGTTGTACTGCAGC CCTAGAACCGTGAAGAGCAT CAGGAAAGTCAGCTGCTATC ATGGCATCCAGTCCCTGTAT AAAGAACAGGAACTCTCCCC TCTGGTCTTCTGGCTCATGC GGTCAAGACCTAAGGAGTGG CATCACTGAGTTCCTGGACA CGATCAGCGTCATAGTCCTT ... FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ATCACCACACAGTCCTCTCCG GGCCTGTCTGCTTCTTGTAA...
  • 12
  • 521
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Contribution of cysteine residues in the extracellular domain of the F protein of human respiratory syncytial virus to its function" docx

Hóa học - Dầu khí

... C3 22S C3 33S C3 43S C3 58S C3 67S C3 82S C3 93S C4 16S C4 22S C4 39S complete minimal reduced complete reduced minimal minimal minimal minimal minimal complete reduced minimal complete minimal Total protein ... an intervening cysteine-rich region A hydrophobic transmembrane domain is located near the C- terminus of the protein followed by a short (26 residues) cytoplasmic domain containing a single cysteine ... 32 C 33 C 34 C 35 C 36 C 38 C 39 C 41 C 42 C 43 W T L1 38 R Figure Fusion activity of cysteine mutations Fusion activity of cysteine mutations 293T cells were transfected with plasmids encoding...
  • 11
  • 343
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt

Hóa học - Dầu khí

... in contrast to findings for the LCMV glycoprotein where an endo H-resistant form of GP -C was described [22] However, since cleavage of Lassa virus GP -C by SKI-1/S1P occurs earlier in the exocytotic ... streptomycin Antibodies Oligopeptide comprising the amino acids 477–491 of preGP -C was chemically synthesized and covalently linked to keyhole limpet hemocyanin (KLH, Pierce) as a carrier protein by the ... times with cold phosphate-buffered saline (PBS) and then cell surface was incubated twice for 15 at 4 C with mg/ml sulfo-Nhydroxysuccinimidobiotin (Pierce) by adding ml of the biotinylating reagent...
  • 7
  • 363
  • 0
báo cáo hóa học:

báo cáo hóa học:" In vitro suppression of the MMP-3 gene in normal and cytokine-treated human chondrosarcoma using small interfering RNA" doc

Hóa học - Dầu khí

... 5'-CAACACTGCCAACGTCCAGAT-3' Reverse: 5'-CTGCTTCGTCCAGATAGGCAAT-3' Forward: 5'-ACTTCCGCTGGTCAGATGGA-3' Reverse: 5'-TCTCGTGCCAGATCATCACC-3' Forward 5'-CGGCCTGTTCCCCTTCTTCGTG-3' Reward 5'-TCGTGTGCTACGCTGCGGACCA-3' ... quantitative PCR Gene Primer sequences MMP-3 (NM_002422) Forward: 5'-CTTTTGGCGAAAATCTCTCAG-3' Reverse: 5'-AAAGAAACCCAAATGCTTCAA-3' Forward: 5'-AACTCCGACATCGTGATCCG-3' Reverse: 5'-GTAGTAGCAGGACTTG ATCT-3' ... chondrocyte and synovial fibroblasts, may cause an imbalance in extracellular matrix (ECM) turnover, accelerate the degradation of the cartilage matrix, and also increase the incidence of chondrocyte...
  • 10
  • 388
  • 0
Thảo luận tiếng anh: Provide stages in developing and launching the products and suggest         some solution to make your products always your customer’s wants.

Thảo luận tiếng anh: Provide stages in developing and launching the products and suggest some solution to make your products always your customer’s wants.

Anh văn thương mại

... product, packaging material is sure, secure, certified check safety products To the logo and colors of the product: Logo needs to be printed clearly and set in front of packaging, the product with ... Product Commercialization Commercialization of the product is actually launched the product in the market It’s not an independent work It involves strategy, resources of business, policy, infrastructure ... lifecycle Accordingly, in order to have development, testing and launching new products and services On this discussion, the remaining new product and service development stages is made clearly...
  • 15
  • 9,026
  • 62
Báo cáo hóa học:

Báo cáo hóa học: " Enhancement of Sm3+ emission by SnO2 nanocrystals in the silica matrix" ppt

Báo cáo khoa học

... it can be deduced that the SnO2 nanocrystals are indeed introduced in the silica xerogel From the UV–Vis spectrum of the silica xerogel containing Sm3+ ions and SnO2 nanocrystals (Fig 3), it can ... here), suggesting that the size of SnO2 nanocrystals increases These results further confirm that the SnO2 nanocrystals are incorporated in the silica matrix, and the network of silica and SnO2 ... the emission of silica gels No characteristic emission of Sm3+ ions can be observed for the silica xerogel containing Sm3+ ions (curve a), while the sample containing SnO2 nanocrystals and Sm3+...
  • 4
  • 266
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25