0

important water mineral interactions at osper sites that modify the chemical composition of water from various sources

Báo cáo sinh học:

Báo cáo sinh học: " Research Article Interactions between Uterine EMG at Different Sites Investigated Using Wavelet Analysis: Comparison of Pregnancy and Labor Contractions" pdf

Điện - Điện tử

... from the tails of the WLCCsurr distribution, (5) the generated surrogates have the same amplitude information as Y but their phases are randomized The null hypothesis is that the results related ... amplitude and phase of the time series Therefore, we cannot detect the nature of the relation by using the wavelet coherence The aim of this work is to separate the two kinds of information (phase and ... identifying the nature of the relation between EHG signals, we choose to use two different methods that focus on separate aspects of the relationship between the signals, namely, the phase and the amplitude...
  • 9
  • 363
  • 0
Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc

Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc

Báo cáo khoa học

... in the value of DCm It is important to recognize therefore that denaturation midpoints in the presence of half-saturating levels of sulfate were identical within the experimental error for the ... stabilities; and that the Arg fi Ala replacement at position 242 offsets the stabilizing effect of sulfate binding in the wild-type to the extent that this mutation stabilizes the enzyme when no sulfate is ... artifact of the protein folding process in the E coli cytosol, the conversion of the tetramer into its constituent dimers must take place at a slow rate The data suggest that the use of amino-terminal...
  • 11
  • 444
  • 0
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

Hóa học - Dầu khí

... deceived, therefore, by any changes that are produced in water Water is the same everywhere, whether produced from the ocean or from the flame of the candle Where, then, is this water which we get from ... take a towel to wipe off the water; and it is by that kind of wetting, or that kind of attraction which makes the towel become wet with water, that the wick is made wet with the tallow I have known ... have one of the most beautiful illustrations of the general nature of a candle that I can possibly give The fuel provided, the means of bringing that fuel to the place of chemical action, the regular...
  • 164
  • 271
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Chemical composition of the periderm in relation to in situ water absorption rates of oak, beech and spruce fine roots" doc

Báo cáo khoa học

... been suggested that a fine regulation of root water uptake is provided by water channels (aquaporins) in the cell-to-cell passage of water flow in roots [7, 45] Opening and closing of the channels ... the root is monitored at time intervals of 15 s with two sets of thermocouples and a thermopile Axial water flow in the root is calculated for 15-min averages by solving the heat balance equation ... of the studied branch roots to obtain a crude estimate of the water potential at the root surface (Ψsurface) The tensiometer data were taken every 15 and averaged over the three instruments The...
  • 10
  • 331
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Báo cáo khoa học

... all fish that died in the different groups were positive for presence of VHS virus If the fish that were negative for presence of VHS virus are removed from the mortalities the pattern of mortality ... other pathogens that could explain the mortalities of the fish that were negative for presence of VHS virus None of the fish in groups V (N = 11) and KV (N = 16) were positive for VHS virus at ... for further transmission of the virus [36] In this study the number of VHS virus positive fish was few at the termination of the experiment At day 53 only out of a total of 96 survivors from all...
  • 15
  • 252
  • 0
SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR STRESS

SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR STRESS

Y khoa - Dược

... inactivates proteases that initiate the apoptotic pathway In addition, Akt phosphorylates the inhibitor of kappa B (IκB), promoting its degradation and permitting the nuclear translocation of nuclear ... differentiation However, it has been estimated that more than 70% of   12   osteoblasts at sites of bone formation undergo apoptosis (Jilka et al., 1998) Therefore, it has been proposed that inhibiting ... dynes/cm2) of media across the surface of the bone cells The main advantage of using of an oscillatory pump to induce fluid shear stress is the controllable and uniform flow pattern that it produces...
  • 134
  • 134
  • 0
cash cycle factors that influence the desired level of cash optimal cash inventories

cash cycle factors that influence the desired level of cash optimal cash inventories

Tài chính doanh nghiệp

... that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas are inputs to a cash budget and how they affect the ... • Learn about the Cash Cycle • Understand the factors that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas ... maintained in a location separate from cash & checks • Certification of vouchers Collection of funds Need for accelerating collections How to accelerate collection of receivables Disbursement of funds...
  • 33
  • 460
  • 0
Study on the elements that affect the buying decision of milk bottle DR  brown in new generation company limited

Study on the elements that affect the buying decision of milk bottle DR brown in new generation company limited

Tổng hợp

... Koschate (2005) stated that consumer satisfaction has a positive relationship with price acceptability and readiness to pay From that research, these author want to say that higher consumer satisfaction ... design a Data collection (Secondary and Primary data collection) Primary data is information which the author gather by himself and secondary data is information gathered by others sources such ... increased There must be several key reasons for that Therefore, this research will be focused solely on identifying the causes of that situation, and then offering some suggestion to overcome the difficulties...
  • 33
  • 196
  • 0
Tài liệu Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in produced water from the Osage-Skiatook Petroleum Environmental Research sites, Osage County, Oklahoma doc

Tài liệu Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in produced water from the Osage-Skiatook Petroleum Environmental Research sites, Osage County, Oklahoma doc

Tự động hóa

... Table Chemical (inorganic and organic) and isotopic composition of selected water samples from OSPER site B continued Table Important water- mineral interactions at OSPER sites that modify the chemical ... composition that are comparable to that of the produced water source (Fig 7) The salinity of water obtained from the boreholes in the adjacent pit, which has more weathered and degraded oil (18), and from ... showing the salinity of water and the relative concentrations of major cations and anions in a transect from the BA-02 well to well BE07, located in the littoral zone of Skiatook Lake at the OSPER...
  • 30
  • 881
  • 0
Tài liệu Báo cáo khoa học: Computational approaches to understand a-conotoxin interactions at neuronal nicotinic receptors doc

Tài liệu Báo cáo khoa học: Computational approaches to understand a-conotoxin interactions at neuronal nicotinic receptors doc

Báo cáo khoa học

... derived from mutagenesis studies, indicating that the docking simulations probably provide an accurate view of the molecular basis of the interaction PnIB determinants are located lower in the ACh ... regions from the template to the target sequence; (b) generate random loops for the insertions/ deletions (or use a structural database search); (c) assign the coordinates of the chosen loop to the ... close to the outer perimeter of the muscle nAChR at a ˚ distance of 39–45 A from the membrane surface [9] This was later confirmed by the electron microscopy of the ˚ Torpedo receptor at 4.6 A...
  • 8
  • 462
  • 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc

Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc

Báo cáo khoa học

... group of the enzyme A hydrophobic interaction of the side chain of Met1 of Tat(1–9) with the phenyl ring of the substrate Ala-Pro-pNA resulted in a fixation of the aromatic leaving group Rather ... Tat(1–9), the binding affinity of a second inhibitor molecule of Gly3Tat(1–9) or Trp1-Tat(1–9) to the EI complex was decreased On the other hand, in the case of Ile3-Tat(1–9) the formation of the ... oxygen atom of the side chain carboxylic group of Glu668 and between the carbonyl carbon atom of Pro of the substrate Ala-Pro-pNA and the Ser630 oxygen atom of the enzyme to hold the substrate inside...
  • 10
  • 505
  • 0
Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

Báo cáo khoa học

... suggests that K527-conjugation enhances the efficiency of sumoylation at the other site A third line of independent evidence for sumoylation of c–Myb is the interaction between c-Myb and Ubc9, the latter ... to modification at two residues in the NRD part of the protein with K527 being the major sumoylation site The conjugation of SUMO-1 to c-Myb raises the question of the role of this modification with ... Biochem 270) matrix preparation experiment (Fig 6) This experiment also showed that there is an accumulation of sumoylated Myb in the insoluble fraction of the nucleus, indicating that sumoylation stabilizes...
  • 11
  • 556
  • 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học

... reared at 23 °C in recirculating UV-treated tap water at the ÔDe Haar VissenÕ facility in Wageningen Fish were fed dry food pellets (Provimi, Rotterdam, the Netherlands) at a daily ration of 0.7% of ... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... predominates in brain and ovary [10], a pattern that matches the expression of carp CXCL14 The expression of zebrafish CXCL14 in the vestibulo-acoustic system and at the midbrain–hindbrain boundary at...
  • 13
  • 398
  • 0
Factors that Influence Successful Start-Up of Home Visiting Sites pptx

Factors that Influence Successful Start-Up of Home Visiting Sites pptx

Khoa học xã hội

... half of the sites that successfully achieved that start-up outcome and was not present in any sites that did not achieve that outcome Study Sample We include six sites that chose to start the ... lack of an estimate regarding the costs of the pre-implementation phase activities All sites stressed the value of these activities, but they also indicated that there was not clear information ... fidelity was the conflict between requirements of the funders of the sites and the fidelity requirements of the FBP An example of this is in the area of data collection and reporting The State funded...
  • 36
  • 381
  • 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... Our data also show that, when molar equivalent amounts of Vps4p interactors are compared, the amount of Vps4p that binds to Did2p is greater than that bound by any of the other interactors These ... whether there is any correlation between the binding sites on Vps4p and the response of the interacting proteins to ATP binding and hydrolysis, we determined the region of Vps4p that mediates...
  • 14
  • 362
  • 0
báo cáo hóa học:

báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

Hóa học - Dầu khí

... of the continuity of the function qn1j on (0, R) In such a case, the ˜ n satisfy the equation ln (qn2j ) = For the same ˜ elements of the second row of matrix Q ˜ reason as above, we obtain that ... uniqueness of the solution of problems (12), (17), and (18) What is the structure of the solutions of system (12) that increase slower than r-2n-1 in the case where n does not satisfy the condition ... Theorem Let relation (5) hold, and let natural k, ≤ k ≤ s - 1, be such that ak+1 ≤ (k) (k) n ak Then, there exists a unique matrix solution Qn (r) = qnij (r) of Equation 12 such that relation (21)...
  • 11
  • 399
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

Báo cáo khoa học

... motion of the first In this way, they measured the lifetime of T7 RNAP bound to the promoter, from which they could obtain the dissociation rate constant koff In some DNAbinding events that lasted ... The tension on the DNA was calculated from the measured values of Fmag and h They found that the extension versus force curve for a double stranded DNA molecule deviates from the prediction of ... is trapped at the focal point of the laser, and the relationship between the displacement of the particle from the focal point and the applied force can be determined through a calibration procedure...
  • 17
  • 351
  • 0

Xem thêm