immunity—from activation to imprinting t cell memory

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Ngày tải lên : 18/06/2014, 16:20
... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata ... gttcttctatgtggccctttgtct tcttgggctctgggtgattc TCRVB12s1, 12s3 VB13A L36092 tggtgctggtatcactgaccaa ggaaatcctctgtggttgatctg TCRVB13s1, 13s6 VB13B X61445 tgtgggcaggtccagtga tgtcttcaggacccggaatt TCRVB13s2, ... tctcgacgccttgctcgtat TCRVB2s1 VB3 U08314 tcctctgtcgtgtggccttt tctcgagctctgggttactttca TCRVB3s1 VB4 L36092 ggctctgaggccacatatgag ttaggtttgggcggctgat TCRVB4s1 VB5 L36092 gctccaggctgctctgttg tttgagtgactccagcctttactg...
  • 9
  • 568
  • 0
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Ngày tải lên : 09/08/2014, 08:22
... death on cytokine production of stimulated T cells upon coincubation with catecholamines was tested After stimulation of T cells for 48 hours with anti-CD3-mAb and anti-CD28-mAb together with ... of the prototypic Th1 cytokine IFN-γ in CD4-positive T cells [25] Available online http://arthritis-research.com/content/8/5/R138 Little is known about the impact of catecholamines on cytokine ... manuscript preparation UW participated in patient recruitment, statistical analysis, and manuscript preparation HH participated in the coordination of the study and helped with patient recruitment and...
  • 11
  • 363
  • 0
Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

Ngày tải lên : 10/08/2014, 21:23
... sjTRECs and TRBV-BD sjTRECs to evaluate not only the recent total naïve T- cell output but also the specific TRBV subfamily naïve T- cell output from the thymus in patients after HSCT The sjTRECs ... important factor determining the success of immune reconstitution post-HSCT and whether thymicdependent or -independent pathways contribute to Tcell reconstitution post-HSCT Thymic function and ... developmental proximity to the thymus and their concentrations in peripheral blood can be used to estimate thymic output and evaluate thymic function in patients after stem cell transplantation Graft-versus-host...
  • 8
  • 345
  • 0
Báo cáo y học: " The macrophage in HIV-1 infection: From activation to deactivation?" potx

Báo cáo y học: " The macrophage in HIV-1 infection: From activation to deactivation?" potx

Ngày tải lên : 12/08/2014, 23:23
... virion attachment to target cells [56] Another explanation for this discrepancy is the activation and/or differentiation status of macrophages with a more potent inhibitory effect of RANTES on ... extent RANTES, suggesting that HIV-1 infection might be modulated in vivo by activated macrophages [70] It is interesting to note that the CD40/CD40L interaction triggers signalling through TNF ... Infection The prototypic cytokine involved in the deactivation of macrophages is IL-10 Although it is superficially similar to a Th2-type cytokine and is often co-induced with Th2 cytokines in the...
  • 15
  • 324
  • 0
Báo cáo y học: "Plant immunity from A to Z" pot

Báo cáo y học: "Plant immunity from A to Z" pot

Ngày tải lên : 14/08/2014, 08:21
... and that the Pto kinase activity is required for preventing AvrPtoB-mediated ubiquitination of Pto In regard to the virulence function of AvrPtoB, Rathjen reported that AvrPtoB associates with the ... independently of Pto, and thus Fen also appears resistant to AvrPtoB-mediated degradation in these plants, possibly due to the substitution of key lysine residues Martin also noted that both Pto and ... with eukaryotic E3 ubiquitin ligases and ubiquitinates Fen, but not Pto Martin discussed the means by which Pto resists the AvrPtoB E3 ligase activity and hypothesized that Pto actively inhibits...
  • 4
  • 236
  • 0
Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx

Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx

Ngày tải lên : 13/08/2014, 01:21
... display cytotoxic activity directly ex vivo [119-124] One obvious limitation on CD4+ T cell- mediated cytotoxic activity is that cognate antigen is only recognized on target cells that express ... natural regulatory T cells at sites of infection The natural regulatory T cells suppressed effector T cell responses, which interfered with immune control of virus replication and contributed to ... transferred into chronically infected mice [61] (Figure 2) Kinetic studies indicated that deterioration in the ability of effector CD8+ T cells to produce cytotoxic molecules and cytokines begins at weeks...
  • 12
  • 264
  • 0
Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx

Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx

Ngày tải lên : 13/08/2014, 09:20
... differences in the levels of CD4 T cell activation and in the capacity to replicate HIV-1 in vitro could be related to the apparent resistance to infection in this group From the studies conducted, we ... coefficients were computed to assess the strength of the association between two continuous variables 10 11 Competing interests The author(s) declare that they have no competing interests 12 Authors' ... susceptibility to HIV-1 infection documented here may reflect a general lower permissiveness to infection in EUs and may contribute to the protection against HIV-1 transmission, possibly together with other...
  • 9
  • 238
  • 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Ngày tải lên : 23/03/2014, 13:20
... indicated in the text), were fractionated Then, 40 lg of the particulate (membrane + cytoskeleton) fraction protein was examined by Western blotting to determine whether TCDD treatment caused translocation ... Moreover, we found that PKCh, but not PKCd, was activated in TCDD-treated L-MAT cells We suggest that TCDD treatment of L-MAT cells induces signal transduction, leading to very rapid activation of PKCh, ... from the nontransfected cells in the miniMACS column and then tested for caspase-3 activation by treatment with TCDD In this experiment, TCDD-induced caspase-3 activation (that is, apoptosis)...
  • 13
  • 426
  • 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

Ngày tải lên : 18/06/2014, 15:20
... load the Figure Cytotoxicity assay Cytotoxicity assay Multiple AAV vectors for DC loading and the autologous targets generated using the IE1 subgenes Targets were generated by viral loading of the ... stimulated AAV/IE1-specific CTLs We analyzed the ability of the AAV/IE1 vectors to generate IE1 specific-CTLs (optimal ratio E :T; 1:20) To analyze CTL activity, we used the following target cell ... restricted Figure demonstrates that the use of AAV/GFP/ Figure Cytotoxicity assay Cytotoxicity assay Killing was stimulated in a dosedependent manner Killing activity was significantly inhibited...
  • 8
  • 451
  • 0
báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

Ngày tải lên : 18/06/2014, 15:20
... test potential therapies The fact that fibroblasts retain their distinct phenotype in culture supports their use to test putative therapies Although the cultured fibroblasts retain their phenotype ... added This facilitated the rapid attachment of the cells from the biopsy to the flask After at least hours (up to overnight), the flask was returned to the upright position and the cells were cultured ... primary cell cultures originating from actual patients and establishing cellular tests that can help evaluate potential therapy on target wound cells In this report, we demonstrate that cells grown...
  • 9
  • 487
  • 0
báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot

báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot

Ngày tải lên : 18/06/2014, 15:20
... as target cells P(-) indicates T2 -A24 target cells without peptide pulsation K562 target cells were used for monitoring natural killer activity and lymphokine-activated non-specific cytotoxicity ... patient), and stimulated in vitro with survivin-C58 peptide in the presence of autologous monocyte-derived DC or autologous PHA blasts After times stimulation, cytotoxic activity against peptide-pulsed ... an ideal molecular target for cancer immunotherapy With this mind, we attempted to identify a HLA-A24-restricted cytotoxic T- lymphocyte (CTL) epitopes of survivin that were suitable for cancer...
  • 11
  • 410
  • 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

Ngày tải lên : 18/06/2014, 15:20
... NK cells initially-obtained their name due to their natural cytotoxicity against tumor cells requiring no prior sensitization, unlike T cells [4] It is well established that the cytotoxicity ... cytotoxic against the K562 cell line and that 3a-G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate ... Interestingly, we noticed that these receptors are linked to some extent to T cell proliferation as anti-CD3/CD28 activated T cells have a significantly lower Kd than resting autologous T cells...
  • 13
  • 404
  • 0
Báo cáo hóa học: " Open Access Cell and gene therapies: moving from research to clinic" pptx

Báo cáo hóa học: " Open Access Cell and gene therapies: moving from research to clinic" pptx

Ngày tải lên : 18/06/2014, 16:20
... of information essential The goal the JTM Cell and Gene Therapy Section is to advance this field by reporting the results of translational medicine studies and by being a forum for the exchange ... marrow transplantation Transfusion 1983, 23:277-285 Rosenberg SA, Dudley ME: Adoptive cell therapy for the treatment of patients with metastatic melanoma Curr Opin Immunol 2009, 21:233-240 Aiuti ... information, ideas and hypothesis We welcome contributions from all those participating in this field; clinicians, scientists, and engineers from academia, industry and the regulatory community Author...
  • 2
  • 492
  • 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Ngày tải lên : 18/06/2014, 16:20
... T cells To normalize for the impact of persistent growth attributable to primary stimulation, the ratio of growth after restimulation to growth by matched control cells in the absence of restimulation ... matched control cells also often expanded as well To distinguish true restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio ... differentiated effector T cells, but unlike conventional effectors [22], the CD45RA+ CD8 T cells noted after anti-CD3 treatment were consistently CD27+ (Figure 3) and CD57- (data not shown) Effector...
  • 15
  • 503
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66] ... target organ may disturb the positive feedback loop that controls Foxp3 stability, such that Treg cells convert to Teff cells with a high diabetic potential Moreover, Komatsu et al noted that ... not mimic, at least reflect events ongoing at the specific site of inflammation Whether or not those events that are translated into the blood encompass autoantigenspecific Treg cell defects...
  • 12
  • 573
  • 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Ngày tải lên : 18/06/2014, 16:20
... deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells ... antigen exposure and other factors •Limited antigen exposure, with potent co-stimulation could lead to T cells that retain low PD-1 expression through various stages: recently activated, effector ... Low PD-1 Activated / Effector T cells Memory T cells Low PD-1 Antigen Memory T cells Low PD-1 Antigen Epitope-specific T cells Naïve phenotype Exhausted T cells High PD-1 Exhausted T cells High...
  • 11
  • 505
  • 0
báo cáo hóa học: " The microglial "activation" continuum: from innate to adaptive responses" pdf

báo cáo hóa học: " The microglial "activation" continuum: from innate to adaptive responses" pdf

Ngày tải lên : 19/06/2014, 22:20
... cytokines known to promote effector T cell function, and found that the pro-inflammatory Th1-type cytokines IFNγ and TNF-α inhibited Aβ phagocytosis whereas the antiinflammatory Th2-type cytokines IL-4 ... shift from innate activation to adaptive antigen-presenting cell response ensues Additionally, certain anti-inflammatory Th2-type cytokines shift this balance back towards innate phagocytic response, ... presence of the CD40-CD40 ligand interaction In the context of Aβ challenge, CD40 ligation is able to shift activated microglia from innate to adaptive activation Further, it seems that the cytokine...
  • 10
  • 410
  • 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Ngày tải lên : 20/06/2014, 01:20
... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+CTL functionality [1], and the hypothesis that this might contribute to RSV re-infection, must be reassessed ... analyzed by flow cytometry Percentages relative to total CD8+ cells are shown for various cell populations The data are from the experiment shown in Table Page of (page number not for citation purposes) ... replication in the lung Thus, it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of...
  • 8
  • 381
  • 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

Ngày tải lên : 20/06/2014, 01:20
... significant cross contamination of T- cells in the two different IFN-γ ELISPOT assays is very low To evaluate the activity of T- cells that were bound to magnetic beads, PBMC samples were depleted of either ... these assay conditions The ability of CD8 cells to respond to peptide when bound to beads suggests that antigen presenting cells are not required or are not limiting under the conditions of the ... suggests that even with few or no recurrences the immune system is being exposed to virus antigen The strength of the responses would argue that the virus may be continually attempting to reactivate...
  • 15
  • 329
  • 0
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx

báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx

Ngày tải lên : 20/06/2014, 08:20
... reconstitution that includes pre-ART viral, immune activation and CD4 + T cell counts The present study followed a cohort of ART-naïve, HIV-infected South African subjects We demonstrate that metabolic ... individuals, and to further explore the relationship between lipids and viral control Altogether our data indicate that metabolic parameters contribute to predicting the degree of immune reconstitution achieved ... report that did not detect a lack of response to ART in obese subjects [59], we did observe a negative association between waist/hip ratio and CD4 gain, indicating that subjects with low waist to...
  • 9
  • 469
  • 0