0

il 2 ifn g and il 4

Báo cáo sinh học:

Báo cáo sinh học: "Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" potx

Hóa học - Dầu khí

... single ELISAs [15-18] with high accuracy and sensitivity [19 -22 ] The factors analysed were: IL1 -b, IL- 1 receptor antagonist (ra), IL- 2, IL- 4, IL- 5, IL- 6, IL- 7, IL- 8, IL- 9, IL- 10, IL- 12, IL- 15, IL- 16, ... Medicine 20 11, 9 :28 http://www.translational-medicine.com/content/9/1 /28 Page of B A 20 75 50 25 10 0 ICM C NIDCM C C ICM NIDCM D 6 IL- 1 (pg g/ ml) IL- 5 (pg/ /ml) * 15 * IL- 7 (pg/ml) ) IFN- (pg/m ml) ... Translational Medicine 20 11, 9 :28 http://www.translational-medicine.com/content/9/1 /28 IL- 18 Page of TNF GAL3 IL- 1A IL- 7 IL- 6 IL- 5 NOR IL- 9 IFN ET-1 Figure Gene networks in CHF The lines link genes whose...
  • 7
  • 424
  • 0
báo cáo hóa học:

báo cáo hóa học:" Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" pptx

Hóa học - Dầu khí

... single ELISAs [15-18] with high accuracy and sensitivity [19 -22 ] The factors analysed were: IL1 -b, IL- 1 receptor antagonist (ra), IL- 2, IL- 4, IL- 5, IL- 6, IL- 7, IL- 8, IL- 9, IL- 10, IL- 12, IL- 15, IL- 16, ... Medicine 20 11, 9 :28 http://www.translational-medicine.com/content/9/1 /28 Page of B A 20 75 50 25 10 0 ICM C NIDCM C C ICM NIDCM D 6 IL- 1 (pg g/ ml) IL- 5 (pg/ /ml) * 15 * IL- 7 (pg/ml) ) IFN- (pg/m ml) ... Translational Medicine 20 11, 9 :28 http://www.translational-medicine.com/content/9/1 /28 IL- 18 Page of TNF GAL3 IL- 1A IL- 7 IL- 6 IL- 5 NOR IL- 9 IFN ET-1 Figure Gene networks in CHF The lines link genes whose...
  • 7
  • 333
  • 0
Báo cáo y học:

Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

Báo cáo khoa học

... TGGGAGCCGATGACCTATG CAAGAGTGTGAGGACATCGTCCACATCC GCCTCCTTGGCCATCTTGT SP-C CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCT SP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT TGTTGCAAGGCGGCATT ... ng/ml TGFa + d 10 ng/ml KGF, Lane 4: d 10 ng/ml TGFa + d 10 ng/ml KGF with d 20 ng/ml IL- 13, Lane 5: d 10 ng/ml TGFa + d 10 ng/ml KGF with d 100 ng/ml IFN- g White bar: without IL- 13 and IFN- g, ... Page of 13 Table Sequence of Primer and Probes Used in This Study Gene Name Forward Primer Probe Reverse Primer SP-A GCCATTCAGGAGGCATGTG CGGCCGCATTGCTGTCCCA GCCTCATTTTCCTCTGGATTCC SP-B TGGGAGCCGATGACCTATG...
  • 13
  • 256
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Thymoglobulin, interferon-g and interleukin-2 efficiently expand cytokine-induced killer (CIK) cells in clinical-grade cultures" potx

Hóa học - Dầu khí

... representative A TG/ CD3 IFN- IL- 2 IL- 2 IL- 2 IL- 2 IL- 2 IL- 2 IL- 2 IL- 2 10 13 16 19 21 day C 53.9 125 TG 100 75 50 int 100 * 75 50 25 25 0 9.0 60 12. 4 66.3 50 low 60 CD3 30 20 ** 100 75 50 D0 D7 D 14 D21 int ... 14 47.9 Day 21 50.5 0. 52 0.5 1.3 71 .2 3.1 51 .2 0.0 D0 D7 D 14 D21 D0 D7 D 14 D21 24 .6 Day 21 42 . 7 D 14. 9 1.08 3.05 7 . 24 1.6 2. 65 14. 8 12. 90 29 .2 9.63 0.03 0.71 Day 0.11 30 .2 8.65 6.65 0. 62 5.7 4. 55 ... 3 .2 5.1 0.5 43 .9 2. 0 14. 0 2. 9 46 .0 14. 0 3.1 52. 5 1.3 82. 7 64. 5 11.6 80.1 3 43 .6 16.9 28 .7 8.0 59.5 32. 3 17.9 35.1 4. 5 49 .9 17.7 14. 8 0 .2 18.5 2. 4 49.7 10.1 30.9 9 .4 59.5 29 .3 12. 1 35.8 6.9 52. 1...
  • 14
  • 502
  • 0
Tư liệu quý - Địa danh Việt Nam (phần 2: D-G)

Tư liệu quý - Địa danh Việt Nam (phần 2: D-G)

Địa lý

... 56,3 24 8,1 22 5,3 25 1,0 45 0,1 515 ,2 363,0 43 6 ,2 3 04 ,2 317,5 Dân số (Nghìn người) 139,1 101,8 160,1 1 54, 8 1 72, 5 181,5 108,8 1 52, 7 77,0 62, 3 22 7,6 Mật độ (Người/Km2) 128 2 1808 645 687 687 40 3 21 1 42 0 ... 836,1 143 3,1 1773,6 13 54, 0 621 ,3 Dân số (Nghìn người) 186,6 139,0 150 ,2 100,6 100,7 94, 9 55,1 35,9 29 ,7 22 ,1 34 ,2 58 ,4 74, 4 37,9 20 ,2 59,5 66,6 Mật độ (Người/Km2) 7 02 2 12 237 121 153 93 43 32 29 ... 90 ,2 297,9 173,7 105,9 20 3 ,2 2 82, 3 197,3 1 54, 7 Mật độ (Người/Km2) 26 92 84 588 325 25 9 40 8 29 8 20 4 198 Huyện phía N tỉnh Bình Phước, giáp tỉnh Bình Dương Đồng Nai phía TN ĐN Diện tích: 929 km2 Năm...
  • 19
  • 722
  • 5
Toán 7 : Trường hợp bằng nhau thứ 2 ( c.g.c)

Toán 7 : Trường hợp bằng nhau thứ 2 ( c.g.c)

Vật lý

... ∆HGK = ∆IKG Vì : GH = KI · · HGK = IKG GK cạnh chung \ Q Hình 84 Không có tam giác P * Về nhà học thật kỹ tính chất hệ * Làm tập 24 , 26 trang 118 sgk , 27 , 28 , 29 trang 119, 120 sgk ... vuông tam giác vuông hai tam giác vuông hai cạnh g c xen hai cạnh g c nhọn hai cạnh g c vuông Củng cố Bài tập 25 / 118 sgk : Trên hình 82 , 83, 84 có tam giác ? Vì ? G A \1 B / D Hình 82 N H ... dụng trường hợp cạnh – g c – cạnh , phát biểu trường hợp hai tam giác vuông B D E / F A / C * Hệ Nếu hai cạnh g c vuông tam giác vuông hai cạnh g c vuông tam giác vuông hai tam giác...
  • 12
  • 568
  • 0
Lecture 2 Wireless Environment and Wireless LANs

Lecture 2 Wireless Environment and Wireless LANs

Quản trị mạng

... 108 MHz Digital TV • 54 to 88 MHz, 1 74 to 21 6 MHz, 47 0 to 806 MHz Wireless Environment and Wireless LANs Wireless Spectrum (2) 3G Broadband Wireless • 746 -7 94 MHz, 1.7-1.85 GHz, 2. 5 -2. 7 GHz 30 MHz ... in Mobile Wireless Service ● First Generation ( 1G) ■ Mobile voice services ● Second Generation ( 2G) ■ Primarily voice, some low-speed data (circuit switched) ● Generation 2 (2. 5G) ■ Higher data ... together to form a scatternet Wireless Environment and Wireless LANs 50 Comparison with 8 02. 11 Characteristic Bluetooth IEEE 8 02. 11b IEEE 8 02. 11a Spectrum 2. 4 GHz 2. 4 GHz GHz Max Data Rate 725 ...
  • 51
  • 303
  • 0
Practical mod_perl-CHAPTER 24:Mod_perl 2.0: Installation and Configuration

Practical mod_perl-CHAPTER 24:Mod_perl 2.0: Installation and Configuration

Kỹ thuật lập trình

... Edition Copyright © 20 04 O’Reilly & Associates, Inc All rights reserved 701 ,ch 24 .25 990 Page 7 02 Thursday, November 18, 20 04 12: 47 PM Example 24 -3 Apache/PrintEnv2.pm package Apache::PrintEnv2; use ... Configuring mod_perl 2. 0 | This is the Title of the Book, eMatter Edition Copyright © 20 04 O’Reilly & Associates, Inc All rights reserved 707 ,ch 24 .25 990 Page 708 Thursday, November 18, 20 04 12: 47 ... Installing mod_perl 2. 0 | This is the Title of the Book, eMatter Edition Copyright © 20 04 O’Reilly & Associates, Inc All rights reserved 695 ,ch 24 .25 990 Page 696 Thursday, November 18, 20 04 12: 47 PM...
  • 24
  • 483
  • 0
Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx

Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx

Quản trị mạng

... type disconnect and press Enter Upon completion of the previous steps, logoff by typing exit Turn the router off 2- 4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2. 3 Copyright  20 03, Cisco Systems, ... Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config The responding line prompt will be: Erasing the nvram filesystem will remove all files! Continue? ... started! Press Enter The router is ready for the assigned lab to be performed 3 -4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2. 3 Copyright  20 03, Cisco Systems, Inc Router Interface Summary...
  • 4
  • 544
  • 4
Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions doc

Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions doc

Quản trị mạng

... type disconnect and press Enter Upon completion of the previous steps, logoff by typing exit Turn the router off 2- 4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4 .2 Copyright  20 03, Cisco Systems, ... Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config The responding line prompt will be: Erasing the nvram filesystem will remove all files! Continue? ... privileged exec mode enter the command reload Router(config)#reload The responding line prompt will be: System configuration has been modified Save? [yes/no]: Type n and then Enter The responding...
  • 4
  • 441
  • 0
Tài liệu Bài 2: Random Vectors and Independence pdf

Tài liệu Bài 2: Random Vectors and Independence pdf

Ngân hàng - Tín dụng

... the mean Efxg of x is nonzero [319, 386, 149 ] = Efxg = Efx2 g = Efx3 g = Efx4 g Efxg ]2 fx2 gEfxg + Efxg]3 2 4Efx3 gEfxg + 12Efx2 g Efxg ]2 Efx g] 3E (2. 1 04) Efxg ]4 42 RANDOM VECTORS AND INDEPENDENCE ... INDEPENDENCE g Here J is the Jacobian matrix J x y Ax 6 6 g( x) = @g2 (x) @x1 @g2 (x) @x2 @g1 (x) @x1 @g1 (x) @x2 @g2 (x) @xn @g1 (x) @xn @gn (x) @x1 @gn (x) @x2 @gn (x) @xn 7 7 (2. 83) gx and gj ... formula (2. 22) , which is a common practice in signal processing, neural networks, and engineering In 23 EXPECTATIONS AND MOMENTS 5 y y 3 2 1 x −1 −1 2 2 −3 −3 4 x 4 −5 −5 4 −3 2 −1 Fig 2. 2 An...
  • 43
  • 430
  • 0
Tài liệu Lesson 2: Expressions, Types, and Variables doc

Tài liệu Lesson 2: Expressions, Types, and Variables doc

Kỹ thuật lập trình

... size, and range Type sbyte Size (in bits) Range - 128 to 127 byte short 16 to 25 5 - 327 68 to 327 67 ushort 16 to 65535 int uint 32 32 -21 47 483 648 to 21 47 483 647 to 42 9 49 6 729 5 long 64 - 922 33 720 368 547 75808 ... point and decimal types, their size, precision, and range Type Size (in bits) Precision float 32 digits double 64 15-16 digits decimal 128 28 -29 decimal places Range 1.5 x 10 -45 to 3 .4 x 1038 ... myStrings[0] = "Joe"; myStrings[1] = "Matt"; myStrings [2] = "Robert"; Console.WriteLine("myStrings[0]: {0}, myStrings[1]: {1}, myStrings [2] : {2} ", myStrings[0], myStrings[1], myStrings [2] ); }...
  • 8
  • 417
  • 0
Tài liệu Lab 3.1.2 Command Modes and Router Identification docx

Tài liệu Lab 3.1.2 Command Modes and Router Identification docx

Quản trị mạng

... logoff by typing exit Turn the router off 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1 .2 Copyright  20 03, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged ... mode Router(config-if)#exit 2- 5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1 .2 Copyright  20 03, Cisco Systems, Inc Step Assign a name to the router a Router(config)#hostname GAD b What prompt ... router mode and go into interface configuration mode a Enter exit at the prompt to return to global configuration mode Router(config-router)#exit b Enter interface serial at the global configuration...
  • 5
  • 411
  • 0
Tài liệu Lab 3.1.2 Command Modes and Router Identification doc

Tài liệu Lab 3.1.2 Command Modes and Router Identification doc

Quản trị mạng

... Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config The responding line prompt will be: Erasing the nvram filesystem will remove all files! Continue? ... of the router GAD(config)#exit Upon completion of the previous steps, logoff by typing exit Turn the router off 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1 .2 Copyright  20 03, Cisco ... privileged exec mode enter the command reload Router(config)#reload The responding line prompt will be: System configuration has been modified Save? [yes/no]: Type n and then Enter The responding...
  • 5
  • 332
  • 0
Tài liệu Cisco Remote Access to MPLS VPN Integration 2.0 Overview and Provisioning Guide doc

Tài liệu Cisco Remote Access to MPLS VPN Integration 2.0 Overview and Provisioning Guide doc

Quản trị mạng

... Management 4 -22 Fault Monitoring 4 -22 SLA Reporting 4 -22 PPPoX with SSG Event Sequences 4 -22 Logging On To SSG 4 -23 Logging On To a Service 4 -23 PPPoX with SSG Provisioning 4 - 24 Configuring the ... 4- 40 DSL L2TP VHG/PE Routers 4- 41 DSL L2TP LACs 4- 41 DSL L2TP Radius Servers 4- 41 Address Management 4- 42 Accounting 4- 42 DSL L2TP Core Network 4- 43 VPN Management 4- 43 Network Management 4- 43 ... 4- 44 VHG Farms 4- 44 Fault Monitoring 4- 45 SLA Reporting 4- 45 DSL L2TP Event Sequence 4- 46 DSL L2TP Provisioning 4- 46 Miscellaneous Component Configurations 4- 47 Configuring the PE Routers 4- 48...
  • 176
  • 392
  • 0
Tài liệu Module 2: Configuring Web and FTP Sites doc

Tài liệu Module 2: Configuring Web and FTP Sites doc

Hệ điều hành

... 1 92. 168.1 14. 10 1 92. 168.1 14. 10 http://sales http://sales Web Site 1 92. 168.1 14. 10: 1 92. 168.1 14. 10: 1050 1050 1 92. 168.36.17 1 92. 168.36.17 http://research http://research 1 92. 168.1 14. 10 1 92. 168.1 14. 10 ... windows and log off a Close all windows and log off Module 2: Configuring Web and FTP Sites 21 Exercise Changing the Master Properties In this exercise, you will change the master properties and ... http://server_nameB/RVDir and then press ENTER c Close Internet Explorer Module 2: Configuring Web and FTP Sites 27 Exercise Creating and Configuring a New FTP Site In this exercise, you will create and configure...
  • 38
  • 342
  • 0
Tài liệu Pro .NET 2.0 Code and Design Standards in C# docx

Tài liệu Pro .NET 2.0 Code and Design Standards in C# docx

Kỹ thuật lập trình

... 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page i Pro NET 2. 0 Code and Design Standards in C# Mark Horner 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page ii Pro NET 2. 0 Code and Design Standards in C# Copyright © 20 06 ... (Apress, 20 04) Jon would like to thank his family, his colleagues, and the great group at Apress for supporting his writing efforts xv 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page xvi 560 -2 fm.qxd 10 /27 /05 4: 30 ... Language and C++ Working Groups of the Object Data Management Group (ODMG) and has coauthored many books on NET and C#, including Beginning C# Databases: From Novice to Professional (Apress, 20 04) and...
  • 361
  • 925
  • 0
Tài liệu Báo cáo khoa học: Paradoxical interactions between modifiers and elastase-2 Patricia Schenker and Antonio Baici docx

Tài liệu Báo cáo khoa học: Paradoxical interactions between modifiers and elastase-2 Patricia Schenker and Antonio Baici docx

Báo cáo khoa học

... DU None Ch6S, 0 .2 lM DU Ch6S, 20 0 lM DU 87.7 1 42 . 5 37.7 79.3 22 9.9 1 12. 0 1 04. 4 147 .8 94. 6 24 92 ± ± ± ± ± ± ± ± ± Fold increase or decrease 2. 2 9 .2 1 .2 4. 5 14. 5 12. 4 12. 8 9.7 23 .2 when used at ... neutrophil FEBS Journal 27 7 (20 10) 24 86 24 95 ª 20 10 The Authors Journal compilation ª 20 10 FEBS P Schenker and A Baici 24 25 26 27 28 29 elastase by a1-proteinase inhibitor J Biol Chem 26 6, 15356–153 62 ... 3687 26 48 8 23 22 9 65 668 520 2 25 29 7 20 9 12 63 023 3888 1 .20 3 1 .23 3 1.117 1 .41 1 Approximately Approximately Approximately Approximately electrostatic interactions between the 18 positively charged...
  • 10
  • 588
  • 0
Pro .NET 2.0 Code and Design Standards in C# ppt

Pro .NET 2.0 Code and Design Standards in C# ppt

Kỹ thuật lập trình

... 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page i Pro NET 2. 0 Code and Design Standards in C# Mark Horner 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page ii Pro NET 2. 0 Code and Design Standards in C# Copyright © 20 06 ... (Apress, 20 04) Jon would like to thank his family, his colleagues, and the great group at Apress for supporting his writing efforts xv 560 -2 fm.qxd 10 /27 /05 4: 30 PM Page xvi 560 -2 fm.qxd 10 /27 /05 4: 30 ... Language and C++ Working Groups of the Object Data Management Group (ODMG) and has coauthored many books on NET and C#, including Beginning C# Databases: From Novice to Professional (Apress, 20 04) and...
  • 361
  • 629
  • 1
O’Reilly Radar Web 2.0 Principles and Best Practices pot

O’Reilly Radar Web 2.0 Principles and Best Practices pot

Quản trị mạng

... including Google Maps and GMail following this approach The Google Maps beta was publicly launched in February 20 05 and stayed in beta for eight months During that time, Google gained significant ... variety of guises, names, and technologies: social computing, user-generated content, software as a service, podcasting, blogs, and the read–write web Taken together, they are Web 2. 0, the next-generation, ... and gained valuable early-mover advantage, which put it far ahead of slower competitors like Microsoft and Yahoo! (see Figure 36) February 8, 20 05 Google Maps Launch April 20 05 Satellite Images...
  • 9
  • 397
  • 0

Xem thêm