ii— impaired gallbladder motility and gallstones
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used ... CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...
- 13
- 439
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc
... template and the oligonucleotides 5¢-TTGGTGGGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction sites are underlined and start- and stop-codons ... FMN, mM sodium acetate, and 10.8 mM IPP and 10.8 mM DMAPP, respectively; *, internal standard (acetate) FMN, we observed the appearance of the signals of both methyl groups and of the methine group ... Mycobacterium sp and Streptomyces sp.), but also in the Bacteroidetes group (Cytophaga hutchinsonii), and some in the a-subgroup (Rhodobacter sphaeroides and Silicibacter pomeroyi) and in the c-subgroup...
- 12
- 692
- 0
Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx
... reported, and might be the starting point for the development of potent and 1884 Scheme KATII natural substrates (KYN and AAD) and inhibitors: ESBA [55,57], CSA [59], MPP+, 3-NPA [61], OPS [60], and ... KG Km þ ½KG ð1Þ ð2Þ and K0 ¼ KYN aKm Á ½KG KG þ ½KG Km ð3Þ where V¢max and K¢ are apparent Vmax and Km, a is k4 ⁄ k2 KYN (see reaction mechanism in Discussion), and Km and KG Km are the Michaelis ... absorption and fluorescence properties and (b) the transamination and the b-elimination in the presence of substrates and substrate analogs of recombinant human KATII and a variant carrying the Tyr142...
- 19
- 401
- 0
Pocket Atlas of Sectional Anatomy Computed Tomography and Magnetic Resonance Imaging - Volume II Thorax, Heart, Abdomen, and Pelvis (Part 1 ) pptx
... processing and storage 12345 Moeller, Sectional Anatomy © 2007 Thieme All rights reserved Usage subject to terms and conditions of license V Dedicated to our parents, Alfred and Friedel Möller and ... Weber, and Tanja Breunig, and also to Birgit Reuter and Marion Hellinger of the Siemens Manufacturing Center We owe the good coronary CTs on our 64-line CT to our colleagues Christoph Buntru and ... undergoing continual development Research and clinical experience are continually expanding our knowledge, in particular our knowledge of proper treatment and drug therapy Insofar as this book mentions...
- 138
- 418
- 3
Pocket Atlas of Sectional Anatomy Computed Tomography and Magnetic Resonance Imaging - Volume II Thorax, Heart, Abdomen, and Pelvis (Part 2 ) doc
... 31 32 Rib Intercostal artery, vein and nerve Intercostalis muscles Costodiaphragmatic recess Latissimus dorsi muscle Adrenal gland Right kidney Renal artery and vein Ureter Quadratus lumborum ... 22 Diaphragm (lumbar part) 23 Splenic artery and vein 24 Adrenal gland 25 Left kidney 26 Intertransversarii muscles (lateral lumbar) 27 Renal artery and vein 28 Latissimus dorsi muscle 29 Erector ... subject to terms and conditions of license 165 166 MR Angiography of the Splenic and Portal Veins Moeller, Sectional Anatomy © 2007 Thieme All rights reserved Usage subject to terms and conditions...
- 116
- 362
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. II. Daily actual evapotranspiration and soil water reserve" potx
... area expansion and leaf fall, daily transpiration was calculated with an equation based on daily PET and on a relative LAI (LAIi/LAImax), with i standing for the day and LAImax standing for the ... floor development and transpiration different among plots 3.4 Water use in each plot: T and ET T and ET in each plot, for each year and each canopy layer are summarised in Table IV Stand transpiration ... varied between 18.2 and 27.7% in the thinned plot and between 22.3 and 43.4% in the control plot In the thinned plot, In% during winter 2000–2001 is similar between leafy and non-leafy periods,...
- 9
- 319
- 0
Báo cáo y học: "Early and stable upregulation of collagen type II, collagen type I and YKL40 expression levels in cartilage during early experimental osteoarthritis occurs independent of joint location and histological grading" ppt
... about × mm2 in area, including cartilage and bone, was excised with a hammer and chisel from the lateral and the medial femoral condyle and from the lateral and the medial tibial plateau For molecular ... instructions, and was quantified and tested for quality by measurement of the optical density at 280 and 260 nm in a NanoDrop ND100 photometer (Kisker, Steinfurt, Germany) First-strand cDNA was ... purified and sequenced, and specific primers were designed based on this sequence: GAPDH, 5'GATTGTCAGCAATGCCTCCT-3' and 5'-GTGGAAGCAGGGATGAT-GTT-3' ; col I A1, 5'-GAGAAAGAGGCTTCCCTGGT-3' and 5'-AGGAGAACCATCTCGTCCAG3'...
- 10
- 362
- 0
Báo cáo y học: "Inhibition of macropinocytosis blocks antigen presentation of type II collagen in vitro and in vivo in HLA-DR1 transgenic mice" docx
... design, and was responsible for data acquisition, analysis and interpretation as well as manuscript preparation CMUH, CVH, DMA, NM, HR, JDI and RH contributed to study design and data analysis and ... the 488 excitation laser and emission was detected between 500 and 560 nm Images were collected using 0.5 μm Z-steps and these were projected using maximal projection and overlaid with single ... treatment CII, stained and imaged at the same gain and offset levels as the positive cells and no fluorescence was observed Results Mechanisms of CII uptake in macrophages and DCs To study the...
- 11
- 419
- 0
Báo cáo y học: " Differential patterns of intronic and exonic DNA regions with respect to RNA polymerase II occupancy, nucleosome density and H3K36me3 marking in fission yeast" pps
... SM and JB designed and supervised the research and discussed the results; BTW, SM, and SC all performed experiments with help from SW and SA BTW analyzed the data with the help of JB and SM and ... data for the upper and lower strand, respectively, obtained from random-primed RNA hybridized to Affymetrix tiling arrays with each point representing a single probe The second and fourth panels ... signals from Affymetrix tiling arrays Promoter and terminator regions are taken as 400 bp up- and downstream of the start and stop codons, respectively, and divided into 10 bins of 40 bp each, while...
- 12
- 399
- 0
Báo cáo y học: "Knockdown of Rab5a expression decreases cancer cell motility and invasion through integrin-mediated signaling pathway" ppsx
... cell motility and invasion by regulating the expression levels and activities of integrins and their downstream signaling molecules Further studies on Rab5a may help us to fully understand tumor ... decreases cancer cell motility and invasiveness To examine whether Rab5a is relative to the progression of cancer cell invasion and metastasis in vitro, human cervical carcinoma HeLa and SiHa cells ... Figure Knockdown of Rab5a decreases HeLa cell motility and invasion (A) In Control and Rab5a-siRNAs cells, the expression of Rab5a was confirmed, and the number of the cells that invaded through...
- 9
- 323
- 0
Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx
... corresponding to years 1997, 1998, 1998 and 1999) and from recipient C (C2, C3, C5, C6, C8, C10 and C11 from 1992, 1992, 1993, 1994, 1994, 1998 and 1999 respectively) and used to generate the GFP-Vpr ... localisation and nuclear import In total, HIV-1 vpr clones were isolated from donor A (A1, A3, A5 and A6 corresponding to years 1996, 1998, 1999 and 2000), from recipient B (B3, B4, B5 and B6 corresponding ... project grant #222744 to SCP and DAJ, and NHMRC Senior fellowship #384109 to DAJ References 10 11 12 13 14 15 16 17 Heinzinger NK, Bukinsky MI, Haggerty SA, Ragland AM, Kewalramani V, Lee MA,...
- 7
- 268
- 0
Báo cáo y học: " Impaired RNA incorporation and dimerization in live attenuated leader-variants of SIVmac239" potx
... from the SIVmac239 wild-type leader (I.) and attenuated mutants pU∆19 (II.) and pD∆60 (III.) [51] Fig I, arrows labeled a, b, c, and d denote SL1, SL2, SL3 and SL4, respectively, in the SIVmac239 ... results (Fig 5C) show that pU∆39, pU∆33 and pU∆19 were severely replication impaired in primary cells The pU∆14 and pU∆6 mutants were not significantly affected and retained replication kinetics indistinguishable ... protein expression and viral core ultrastructure of wild type and mutant viral particles Figure of Analysis of protein expression and viral core ultrastructure of wild type and mutant viral particles...
- 14
- 358
- 0
Báo cáo y học: " Serum levels of soluble Fas, soluble tumor necrosis factor-receptor II, interleukin-2 receptor and interleukin-8 as early predictors of hepatocellular carcinoma in Egyptian patients with hepatitis C virus genotype-4." pps
... values for sTNFR-II and IL-8 among PNALT and HCC patients yielded a cutoff of 398 pg/ml and 345 pg/ ml, respectively, as shown in Table 4, and Figures and ROC curve for IL-2R and sFas is shown ... significant correlation between sFas, in the one hand, and sTNFRII or IL-2R, in the other hand (p = 0.01 and 0.000, Table Serum levels of sFas, sTNFR-II, sIL-2R and IL-8 in the different study groups Cytokines ... treatment and recurrence of HCC as well [17] Circulating TNF-a level increases during HBV [18-22] and HCV infection [18,23-26] and is correlated with the severity of hepatic inflammation, fibrosis and...
- 12
- 312
- 0
Báo cáo sinh học: "Genetic study on Dandarawy chickens. II. Heritability of live and carcass measurements" ppsx
... mean body weights in Dandarawy chickens were 419 and 636 g at 12 and 16 weeks of age, and that the body conformation in Dandarawy was better than in Fayoumi chickens at 12 and 16 weeks of age Ricard ... measurements at 12 and 16 weeks of age (Falconer, 1981 ) Results The means and standard deviations of live and carcass measurements at 12 and 16 weeks of age are given in Table I The dressing and giblet ... heritability Materials and Methods Animals Three hundred and fourteen chicks (males) were obtained from 33 sires and 157 dams, with full-sibs per dam from a random-bred population of Dandarawy maintained...
- 5
- 149
- 0
Báo cáo sinh học: " Estimation of crossbreeding parameters between Large White and Meishan porcine breeds. II. Growth before weaning and growth of females during the growing and reproductive periods" potx
... and parity of the dam L2!k&dquo;,, = random litter within farrowing batch, genetic type and parity effect, with mean and known variance Œ¡ ijklmn E = random residual effect, with mean and ... favour of LW for WB and W21 Maternal heterosis effects increased sharply between birth and weaning (4, 16 and 14% for UWB, UADG 0-21 and UW21 respectively) Grand maternal and paternal heterosis ... pre-weaning, growing and reproductive periods) were considered Weights at birth (WB) and at 21 d of age (W21) were recorded in 3731 and 3401 piglets respectively Weights at 73 (W73) and 154 (W154)...
- 15
- 302
- 0
Petersons SAT II success MATH 1c and 2c 2002
... collection is $1.20, how many are dimes and how many are nickels? (A) (B) (C) (D) (E) 10 dimes and nickels dimes and nickels 11 dimes and nickels dimes and nickels dimes and nickels www.petersons.com diagnostic ... two points P(a, 3) and Q(4, 6) is 5, then find a (A) (B) (C) (D) (E) 24 24 and 0 and 10 Line m has a negative slope and a negative y-intercept Line n is parallel to line m and has a positive ... gives the number of squares in the nth arrangement? (2, 0) and (1, 0) (0, 2) and (0, 1) (0, 21) and (0, 22) (21, 0) and (22, 0) (21, 0) and (2, 0) www.petersons.com (A) 2n2 (B) 2(2n 1) (C) n~n...
- 404
- 380
- 0
Enhancing musical experience for the hearing impaired using visual and haptic displays
... information to the hearing -impaired Russ Palmer, a hearing and visually impaired person, has worked on a new approach in understanding how people with sensory impairment perceive and interpret music ... for his advices and comments; Tim Merritt and Nicolas Escoffier, for discussions on conducting user studies; Norikazu Mitani for assistance in recording and extracting videos; and Hiroki Nishino ... were bad and making Singapore feel like home My closest and dearest friends, especially Melani Jayasuriya, thanks for bearing up with me all these years and being there for me in good times and bad...
- 174
- 360
- 0
Mixed mode i II III fracture criterion and its application to cement mortar 1
... Nayeb-Hashemi et al (1987), Hyde and Chambers (1988), and Mahajan and Ravi-Chandar (1989) However, the work of Tanaka (1974), Royer (1986) and Abdel-Mageed and Pandey (1992) not support the criterion ... pure modes I and II, and mixed mode I – II, loading In practice, however, engineering structures undergo mixed mode loading involving in-plane and/ or out-of-plane bending and torsion and/ or tension ... Fellow, Dr T Tamilselvan, and all technicians and colleagues in the Geotechnical Laboratory and Concrete and Structural Engineering Laboratory for their kind co-operation and assistance in the research...
- 84
- 158
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25