if you have an important point to make don t try to be subtle or clever use a pile driver
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... chemotherapy Patients and methods Patients Patients diagnosed with PTCL between January 2000 and December 2009 from Korean institutions were evaluated for inclusion into the study Patients with a diagnosis ... found that lymphopenia is an unfavorable prognostic factor for patients with PTCL-NOS treated with anthracycline-containing chemotherapy Higher IPI Table Multivariate analysis for overall survival ... prognostic factor for poor OS and PFS in patients with PTCL-NOS treated with anthracycline-containing chemotherapy Lymphopenia was also a useful marker for further stratification of patients at high...
- 9
- 312
- 0
Explaining the effects of an intervention designed to promote evidence-based diabetes care: a theory-based process evaluation of a pragmatic cluster randomised controlled trial pot
... diabetes A structured dataset was completed on paper forms and returned to the central register; from these data, both patient-specific and aggregated information were provided annually to patients ... may have been that the automated prompts to patients and clinicians regarding the need for a review consultation resulted in increased concordance in interactions between patients and clinicians ... group This is what was found in the trial Thus, the results of the current study support the principle that attitudinally-driven intentions are better translated into action than are normatively-driven...
- 11
- 356
- 0
Child Tax Credit and Working Tax Credit - What to do if you think your Child Tax Credit/Working Tax Credit is wrong ppt
... is correct and explain it If you are happy with the explanation, you ll need to withdraw your appeal If you not agree or if you think we’ve dealt with all points in your appeal, your case can ... How to appeal Your appeal needs to be in writing You can: • complete and send the attached appeal form to us or • send us a letter — give your name — National Insurance number and — the date shown ... affect any right of appeal Customer Information Team January 2012 © Crown copyright 2012 Page Appeal form Please fill in this form if you want to appeal against your tax credits decision About you...
- 4
- 367
- 0
The Fast Food Diet Lose Weight and Feel Great Even If You’re Too Busy to Eat Right ppt
... important to recognize a good fat and a bad one The biggest public enemies in the fat world, according to Dr Sears and most scientists today, are saturated fats and trans fats Why are they so bad? ... The next morning, eat that same bagel slathered with a tablespoon or two of peanut butter You ll see that this extra protein will keep you full for at least an additional two hours Try to eat ... stored fat, promoting weight gain Unfortunately, many fast-food menu items contain massive amounts of saturated fat and trans fat These fats not only pack twice the amount of calories as protein...
- 258
- 2,751
- 0
Starting and Running a Greeting Cards Business: Lots of Practical Advice to Help You Build an Exciting and Profitable Business
... endless, and available in art and craft shops, stationery shops and specialist stores Remember before buying in quantity to test them to make sure that they will stick to the surface you require, and ... supplies, but it is important to research the market thoroughly Many manufacturers demonstrations at large stores and it is a good idea to attend these to increase your knowledge When you find out which ... If you have a talent for painting, photography, calligraphy and writing then you may want to use it in the business; if you don t want to make and sell the cards yourself then consider setting...
- 240
- 714
- 0
REMEMBERING WHAT YOU HAVE TO SAY? pot
... contact is with the manuscript and not with the audience To maintain eye contact with the audience and read text effectively takes a lot of practice You have to take in several lines at a time and ... refer to during your presentation Also, if you are using an overhead projector and it breaks or the bulb burns out and you don' t have a replacement or time to change to bulb, you can refer to your ... numbers are the easiest target words to say slowly and with emphasis You want to emphasize each syllable of any number word For example, if you have the word "fifty" in your speech, and it appears...
- 34
- 569
- 0
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc
... 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ PCR products were directly cloned into pBSK+ cloning ... amplification enzyme, pCDA401 as a template and the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ ... 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and the PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then into pRSETB vector using XhoI and HindIII restriction endonucleases...
- 18
- 400
- 0
You Go to Elections with the Voting System You Have: Stop-Gap Mitigations for Deployed Voting Systems pot
... counting attacks are both easier to mount and harder to detect and compensate for: easier to mount because it is easier to obtain access to the DREs than the optical scanners; harder to detect and compensate ... be malicious Because software cannot be trusted to handle malicious data safely, any contact that the EMS machines have with suspect data is a potential vector for compromise This paper focuses ... means that an outsider would need to attack each device individually, thus dramatically increasing the cost of such an attack The primary attack vector on this type of system is to attack the paper...
- 14
- 634
- 0
If You''''re Clueless About Accounting and Finance and Want to Know More pot
... Changes Hands When you go to the store to buy groceries, at what point you say that a transaction has been made? a When you pick out the produce and canned goods you want and place them into your ... financial accounting standards are often more rigid than managerial accounting standards For instance, financial accounting statements must be audited And they must conform with generally accepted ... Liability? A liability is an obligation that your company will eventually have to meet For instance, when your company takes out a loan, it is obligated to pay that money back with interest That's a...
- 268
- 1,094
- 0
Are You Stressed? Now that you have had test stress explained to you, and the symptoms have been docx
... preparation software, practice exams, and test-taking tips and strategies for the PSAT, SAT, and AP exams www.learnatest.com—Provides practice exams for the ACT, ASVAB, AP, and SAT exams, and many more ... regular basis • Don t take stimulants Although sodas are a staple of teen life, and it may be tempting to use chocolate and soda to give yourself that extra boost of energy, these stimulants are only ... Practice taking tests If you have taken practice tests, either those that you have created on your own or those that your study buddy has created for you, you will have gotten over the test jitters...
- 21
- 527
- 0
Báo cáo hóa học: " An Improved Way to Make Large-Scale SVR Learning Practical" potx
... propose a new way to make SVR have the similar mathematical form as that of support vector classification, and derive a generalization of SMO to handle regression problems An Improved Way to Make Large-Scale ... for these multipliers, and updates the SVM to reflect the new optimal values The advantage of SMO lies in the fact that solving for two Lagrange multipliers can be done analytically Thus, an entire ... set size, and the number of support vectors for different training algorithms In each data set, the objective values of training error are the same Here we can see that with data set increase, the...
- 7
- 278
- 0
How To Get Started Using Microsoft Access Even If You''''ve Never Used It Before pot
... embed too many photos in your database If possible not embed any at all They will bloat your table and database The best way to show images on your forms are to provide a link to them Store them ... information and useful hints and tips on how to create an Access Database Experience a fresh approach to learning with the aid of a valuable reference manual and a video tutorial that talks to you ... store it’s data It is a good idea to also sketch out how you want to present the data Do you want to see a view of how many sales you got in August? Do you want to know the total value of sales or...
- 34
- 284
- 0
If You''''re Clueless About Financial Planning and Want to Know More pptx
... close your account until the dispute gets resolved or the case is settled in court If it reaches that point you' ll have to get an attorney It's also important to note that defective merchandise to ... decision Your credit record will be tarnished for up to ten years and you may find it difficult later on to get a mortgage or credit You may want to talk with a credit counselor or an attorney beforehand, ... cannot threaten legal action against you or report you as delinquent to a creditreporting agency And while your creditor can report that you are disputing your bill, you can take comfort in the...
- 235
- 843
- 0
How to be happier , wealthier and have people like you more docx
... yourself that you know you can complete Start simple and always be realistic about what you can and cannot achieve That means, if you plan on starting a membership site for stock photography, you ... living your life to its fullest extent It doesn t matter what goals you have, if you want to be more confident, if you want to learn to think positively to help manifest good things in your life, if ... excited about anything The best part about healthy living is that it’s easy You don t need to start eating bean sprouts three meals a day and running three miles before bed to feel good and have...
- 33
- 337
- 0
this will make you smarter new scientific concepts to improve your - john brockman
... causes, purposes, and natural ways of being In ancient Greece, Plato and Aristotle saw the world teleologically—rain falls because water wants to be lower than air; animals (and slaves) are naturally ... cognitive toolkit, the required scientific concept has to be applicable to all humans It needs to make a difference to us as a species, or, more to the point I am going to make, as a key factor ... inheritance and the nature of biology meant that when your parents had a baby, it was anatomically human and mostly fully functional physiologically, but the unique combination of traits that make...
- 288
- 1,700
- 1
báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx
... doubtful validity, especially in naïve participants Adding to that the fact that both responses were re-coded in a way that distorts their original meaning limits any conclusions that can be drawn ... nicotine withdrawal (the last items in the HONC) The authors of the HONC were aware that many of the “symptoms” in this list may be unrelated to smoking, and attempted to resolve this potential confound ... participants’ causal attributions at face value Some even assume that participants can accurately attribute their enjoyment of cigarettes to nicotine: “Several of our subjects seemed to describe a phenomenon...
- 9
- 387
- 0
"how do you say" an activity to teach pronunciation
... pronunciation a few times Step5: Move on to next word and repeat step and Each time the teacher asks the students to say the word for you, nominate another team member by their number The teacher can ... is a team effort The teacher can model the sound again if it is hard and let everyone have another try Step4: Ask a few students to pronounce the word and get the whole class to practise the ... Tip: Try and be very encouraging so this is fun and a challenge and does not make the student feel shy Pick the students to say the word at random, not 1,2,3,4,5,6 It is important that it is...
- 2
- 321
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose