if ss say yes t asks follow up questions like
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx
... 1783 1788 nt | | | | | | | X gene 385 395 405 415 2737M_5-09 CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 ... CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t ... deletions treated with Ssp I restriction enzymes Sample deletions treated with Ssp I restriction enzymes Recognition site of the enzyme SspI in the sequences with bp deletion (left) In the right,...
- 10
- 438
- 0
báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf
... 1783 1788 nt | | | | | | | X gene 385 395 405 415 2737M_5-09 CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 ... CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t ... deletions treated with Ssp I restriction enzymes Sample deletions treated with Ssp I restriction enzymes Recognition site of the enzyme SspI in the sequences with bp deletion (left) In the right,...
- 10
- 359
- 0
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt
... rhGH treatment promotes the restoration of Tcell responses against HIV-1, a restoration that declines with cessation of treatment Since HIV-1+ patients commonly develop growth hormone abnormalities, ... (16–2277) and points out the possibility that hormonal intervention with rhGH might be associated with both de novo generation of T lymphocytes (due to increased thymic output) [50,51] as well ... collected at baseline, weeks 12 and 24 of the study plus a follow up visit at week 48 from the start of the study The patients' informed consent and Ethics Committee approval were obtained for the...
- 13
- 359
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... after the first episode of tachycardia These time intervals (time to diagnosis/time to ablation) differed between the specific SVT (Table 1) The time interval between the first occurrence of the tachycardia ... EAT With respect to the underlying tachycardia, 66.9% of patients with AVNRT, 75% of patients with AVRT and 59.1% of patients with EAT respectively submitted a fully completed questionnaire Time ... symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes)...
- 9
- 679
- 0
The Follow-Up Letter
... reader that FOLLOW- THROUGH suggests that he is not receiving a form letAfter an interview, followter, but rather a letter written specifically through on your part is critical to him If you are ... LETTER 6-14: FOLLOW- UP LETTER—TEACHING ARTIST Like its predecessor, Cover Letter 5-87, this letter is heartfelt and sincere, yet still informative—very effective Ms Leonore Valerio Lincoln Center ... is rcl eal LETTER 6-5: FOLLOW- UP LETTER—SALES/MARKETING Another example of ingenuity following an interrupted interview Enclosing a photo is unusual exactly why it will attract attention! Mr Richard...
- 21
- 302
- 0
Tài liệu Follow-Up of the patient who has received pacemaker pptx
... either the atrial or ventricular voltage output until the initial follow- up visit at months At that P.163 time, usually the pulse output value is reprogrammed to at least twice the capture threshold ... with and without the magnet Figure 11-3 Telephone Rhythm Strip Transmitter The patient is shown holding a battery-operated rhythm strip against his chest On the back of the transmitter are two ... capture of the myocardium and thus allows determination of the lowest safe pulse output associated with greatest battery longevity In contrast to P.162 sensing threshold testing, the lower rate...
- 27
- 400
- 0
Marketing Violent Entertainment to Children: A Fifth Follow-up Review of Industry Practices in the Motion Picture, Music Recording & Electronic Game Industries pdf
... Cuts”) Many of these unrated movies contained content that, if rated with the movie, might have led to an NC-17 rating Finally, the Commission notes that the industry’s inconsistent characterization ... to the Federal Trade Commission Regarding the Commission’s 2006 Study of the Marketing of Violent Entertainment to Children at (Oct 6, 2006) (hereafter “NATO Letter”) NATO reported that one theater ... AND TWISTED: UNRATED.” The implicit message of this packaging is that the unrated DVD version contains content that the MPAA would have rated more restrictively than the rating for the movie’s theatrical...
- 138
- 438
- 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... levels although their effect independent of weight loss could not be assessed due to the very small number of patients on either treatment At the time of last follow- up, however, most patients (76%) ... between the logrank test and the Poisson distribution The p value calculated (from the one-sample log-rank test) depends on the assumption that the number of deaths follows a Poisson distribution ... fibrosis at 82 months Two other patients without fibrosis at presentation progressed to stage fibrosis, one at 28 months and the other at months There was no improvement in any of those histological...
- 7
- 487
- 0
Conservative and Aesthetic Emergency Management in Adolescent with Complex Crown-Root Fracture and Simultaneous Oblique Root Fracture in Upper Maxillary Central Incisor: Clinical Outcome after 18 Months Follow-up Period docx
... most difficult dental injuries to be treated; which is supported in the dental literature that shows significant differences between the treatments offered by dentists possibly related to commitment ... adolescent patients In this context, the re-attachment of the crown-root fragments is of major importance This situation is critical when the patient brings the tooth’s fragments Until today, there ... 2005) It is necessary to explain to the patient the semi-permanent or longterm provisional restoration character of this treatment; that it represents a solution until the end of the tooth’s development...
- 11
- 423
- 1
Global Strategy for Women''''s and Children''''s Health : Accountability Commission follow up Recommendation 10 Global Oversight pptx
... with the systems countries use to monitor and evaluate their national health strategies • Strengthen and harmonize existing international mechanisms to track progress on all commitments made • ... better results Vital events: By 2015, all countries have taken significant steps to establish a system for registration of births, deaths and causes of death, and have well-functioning health ... contraception – antenatal care coverage – antiretroviral prophylaxis among HIV positive pregnant women to prevent mother-to-child transmission of HIV – skilled attendant at birth – postnatal care (within...
- 37
- 231
- 0
báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx
... from the surgical treatment group and 13 patients from the pelvic floor training group dropped out of the study before the second assessment time point The latter patients gave lack of time as the ... floor training A further limitation is that the follow- up- assessment took place only eight weeks post-operatively In view of the fact that the healing process after surgery takes months, it can ... expected, that the QOL of the patients will even improve further Nevertheless it has to be pointed out, that the long-term effect of surgery is again dependent on the strength and functional activity...
- 11
- 456
- 0
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... at three year follow- up and those lost at follow- up Health and Quality of Life Outcomes 2008, 6:92 http://www.hqlo.com/content/6/1/92 Table 4: Estimated associations between the onset of restriction ... Estimates of the onset and persistence of any restriction at three-year follow- up in older adults who completed the KAP at three year follow- up and those lost at follow- up; overall and stratified ... were less likely to report participation restriction (any restriction: 57.8% v 76.5%) There was little difference between the attrition reweighted estimates in any of the onset and persistence...
- 11
- 498
- 0
báo cáo hóa học: " Changes in quality of life among Norwegian school children: a six-month follow-up study" doc
... contributions TJ contributed to the study design, data collection, statistical analysis, interpretation of data and to the drafting of the paper BL contributed to the study design, statistical ... assistant was present at each school when the students filled out the questionnaires They stressed informant confidentiality, responded to questions, and read questions aloud for students with ... for collecting the data The coordinator informed the students about the project and also sent a standard information letter to their parents The principal investigator (the first author) or a...
- 12
- 462
- 0
báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt
... related to 'anxiety or depression' Furthermore, 40.4% reported to have health states other than those presented in Table 3; of those patients, 73 (24.7%) reported a health state with at least one ... calculated To examine differences between participants who http://www.hqlo.com/content/7/1/18 were still in the study after five months and those lost to follow- up, independent samples t- tests (EQ-5Dindex, ... co-existing conditions between respondents and non-respondents at fivemonth follow- up (data not shown) Patient characteristics Table presents the baseline characteristics of the patients Of the...
- 9
- 420
- 0
báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx
... and the age of the patients All tests were two-tailed All data are presented as median values with the 25th to 75th percentiles in parentheses unless stated otherwise Results The concentrations ... patients with definite stroke compared to patients with severe carotid atherosclerosis without clinical event as well The main age of this group was equal to that of stroke patients This control ... independent, indicating that they reflect two different pathways of inflammation contributing to the pathogenesis of the disease These findings may have important therapeutic implications Anti-inflammatory...
- 27
- 434
- 0
báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc
... satisfaction both at T1 and at T2 , the T1 level will most likely explain most of the variance at T2 if the situation is rather stable The data does not, however, allow us to test the direction of the ... health problems at T2 In fact, the adjusted estimates of serious operational tasks were negatively related to emotional exhaustion and psychological distress at T2 A possible interpretation of these ... with regard to the job and satisfaction with regard to the organization can be Low job satisfaction at T2 Emotional exhaustion at T1 Emotional exhaustion at T2 Psychological distress at T1 Psychological...
- 9
- 531
- 0
báo cáo hóa học:" The results of arthroscopic versus mini-open repair for rotator cuff tears at mid-term follow-up" pot
... O'Brien test If the patient had pain localized to the AC joint and had at least of the remaining tests positive, then it was determined that a distal claviculectomy would be performed at the time ... The anterolateral portal was then extended cm for a mini-open repair After splitting the deltoid, all rotator cuff tears were re-measured at the greatest antero-postero diameter of the tear to ... first 20 arthroscopic rotator cuff repairs that met the study inclusion criteria were not included in the current study Only patients later than this group who met the study inclusion criteria...
- 8
- 467
- 0
báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf
... the follow- up Multiple previous operations had been performed before VFG in patients in other institutions prior to attending our hospital We have reported these patients in a study of short-term ... screws End-to-end anasto- Statistical analysis Clinical data were statistically analyzed using the MannWhitney U-test for quantitative data of the term of bone consolidation and leg-length discrepancy, ... on patients younger than the age of years and it is recommended that surgery be postponed until the age of years [6] Another study about bone consolidation in CPT also suggested that the best age...
- 7
- 502
- 0
báo cáo hóa học:" Percutaneous endoscopic lumbar discectomy: clinical and quality of life outcomes with a minimum 2 year follow-up" doc
... rotated to the lateral projection The metal rod is held along the side of the patient in the parasagittal orientation at the level of the index disc While the metal rod is held in this position, the ... these patients had relief of their leg symptoms after the operation One patient had recurrence of symptoms at weeks post-operation, another at months and the third at months post-operation of these ... chi-square test Non-parametric statistics were used for the http://www.josr-online.com/content/4/1/20 Table 1: Patient demographics, operative time, length of hospital stay and duration of followup for...
- 8
- 583
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose