ica joint inflammation is downregulated by oxygen radicals which is compensated for by ifn g
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... Miller for carrying out the human IgG staining, Dr Giorgio Landon for evaluating electron micrographs, and Dr Meryl Griffiths for evaluating the histological slides We thank Louise Rigden and ... were then examined by a histopathologist for morphological evidence of kidney disease Staining for human IgG Formalin-fixed, paraffin-embedded kidney sections were dewaxed and endogenous peroxidase ... dsDNA That this binding is lost on treatment with DNase suggests that the component complexed with B3VH/B33VL is a bridging nucleoprotein of some kind, which is essential for binding of this antibody...
- 13
- 472
- 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... protein produced by this novel labelling procedure The advantage of this labelling method over, e .g chemical ligation of radioactive or fluorescent probes to proteins is that the metabolism of 75Se-labelled ... showing that the Sel-tagged Der p had a preserved protein structure with maintained IgG and IgE-binding epitopes For the comparison of sensitivity of [75Se]Der p detection by autoradiography ... PAGE gels One gel was subsequently Coomassie stained and subjected to autoradiography while the other gel was used for western blot analysis as described above Statistical analyses Statistical...
- 12
- 518
- 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... [11] GTTTGCCATCTTCG-3¢), C33 (forward 5¢-CTACTT GACTTTCAGTACGTGACC-3¢/reverse 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), ... C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward ... 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) Sequences of the primers contained changes of restriction sites that allowed identification...
- 8
- 405
- 0
Báo cáo hóa học: "Multicenter phase II study of matured dendritic cells pulsed with melanoma cell line lysates in patients with advanced melanoma" potx
... JAG, DKO, BC and MIR treated patients within this protocol VGP performed pathological analysis of samples MJR, JH, and AV performed study coordination and data management NB performed immunological ... SD: stable disease; PD: progressive disease cervical lymph node metastases progressing after prior surgical resections and had not received prior systemic therapy for metastatic disease The patient ... resulted in a significant arrest of growth of the lung metastasis The patient underwent surgical resection of all active sites of disease at 13 months after initiating vaccine administration Several...
- 11
- 459
- 0
Báo cáo hóa học: " Are quantum dots ready for in vivo imaging in human subjects?" docx
... QD-based biological probes for in vivo optical imaging is promising for both basic science and clinical applications Nanotechnology has the potential to significantly impact cancer diagnosis and cancer ... prime target for in vivo targeted imaging using QDs, as extravasation is not required to observe tumor signal Arginine–glycine–aspartic acid (RGD; potent integrin avb3 antagonist) containing peptides ... for biological imaging, such as high quantum yields, high molar extinction coefficients (1–2 orders of magnitude higher than organic dyes), strong resistance to photobleaching and chemical degradation,...
- 17
- 377
- 0
báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt
... possessing a “magnetic motor effect” for drug or gene delivery Angew Chem Int Ed Engl 2005, 44:1068-1071 21 Guo J, Yang W, Deng Y, Wang C, Fu S: Organic-dye-coupled magnetic nanoparticles encaged ... near-infrared 2-deoxyglucose optical imaging agent for mouse cancer models Anal Biochem 2009, 384:254-262 66 Wang GJ, Liu Y, Qin A, Shah SV, Deng ZB, Xiang X, Cheng Z, Liu C, Wang J, Zhang L, et al: Thymus ... Choi HS, Fujii H, Bawendi MG, Frangioni JV: Image-guided oncologic surgery using invisible light: Completed pre-clinical development for sentinel lymph node mapping Ann Surg Oncol 2006, 13:1671-1681...
- 14
- 399
- 0
báo cáo khoa học: "BRCAA1 monoclonal antibody conjugated fluorescent magnetic nanoparticles for in vivo targeted magnetofluorescent imaging of gastric cancer" ppsx
... shown in Figure 1, there exists statistical difference between two group (P < 0.01) This result is almost identical to our previous report [4,9-11], which highly suggest that BRCAA1 antigen may ... mice model with gastric cancer were injected FMNPs for 12 h, the mice were performed MR imaging, which did not show intensive signal in tumor area (Figure 8A) Figure MR imaging of MGC803 cells and ... not damage important organs including liver, kidney, heart, lung, etc, also did not exhibit long-term staying in important organs, which highly suggest that as-prepared nanoprobes own good biocompatibility,...
- 12
- 389
- 0
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
... downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' The 141 bp U3 region was removed from the plasmid by BglII digestion ... stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; for stage ... vector packaged by SIV gag-pol 100 80 60 % %GFP/ GFAP 40 20 20ng 10ng % %GFP+ 40ng 20ng Conc of vector added 100 90 80 70 60 50 40 30 20 10 %GFP+ %GFP/ GFAP+ 40ng 5ng 20ng 10ng 5ng Conc of vector...
- 14
- 437
- 0
Báo cáo y học: " A remission spectroscopy system for in vivo monitoring of hemoglobin oxygen saturation in murine hepatic sinusoids, in early systemic inflammation" doc
... visualization of the tissue pO2 This tech- nique allows the visualization of oxygen distribution on tissue surfaces, but this method comprised some technical limitations The oxygen- sensitive membrane ... Clemens MG: High-resolution visualization of oxygen distribution in the liver in vivo Am J Physiol Gastrointest Liver Physiol 2004, 286 :G3 7 -G4 4 Nie RG, McCarter SD, Harris KA, Lee PJ, Zhang X, Bihari ... hemoglobin oxygen saturaCorrelation2) and tissue redox status Figure Correlation between sinusoidal hemoglobin oxygen saturation (HbsO2) and tissue redox status The mean HbsO2 values significantly...
- 8
- 239
- 0
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt
... p11 Figure Organization of the HTLV-2 genome and coding regions Organization of the HTLV-2 genome and coding regions The complete proviral genome is shown schematically Boxes denote long terminal ... [29-31] suggesting the possibility of distinct or additional functions Together, these findings suggest that p30/p28 facilitates virus and/or infected cell survival by regulating viral gene expression ... Gag produced in the culture supernatant of the four cell clones by ELISA Our results showed p19 Gag expression ranging from 250–750 pg/ml (Fig 4A) The variable Page of 11 (page number not for...
- 11
- 277
- 0
Báo cáo toán học: "Iodine Alters Gene Expression in the MCF7 Breast Cancer Cell Line: Evidence for an Anti-Estrogen Effect of Iodine" doc
... using GenePix (Molecular Devices, Sunnyvale, CA.) disregarding signals with a signal to noise ratio < and a sum of the means
- 8
- 290
- 0
Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc
... high affinity for DNA [3] Physiologically, this activity is counteracted by histone acetyl transferases (HATs) which are recruited to gene promoters by specific transcription factor-activating ... uracil group or an amide group in a cis-conformation, which presented the nitrogen-bond hydrogen and the carbonylic oxygen on the same side of the molecule (usually amide groups are in a trans-conformation, ... file 3] Page of 10 (page number not for citation purposes) Retrovirology 2009, 6:52 http://www.retrovirology.com/content/6/1/52 Figure (see legend on next page) Page of 10 (page number not for citation...
- 10
- 418
- 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... nerve signal transmission However, this view has slowly been changing Pathological pain is classically viewed as being mediated solely by neurons, but there is mounting evidence that glial cells ... and this is crucial for normal growth and homeostasis of articular cartilage During osteoarthritis, uncharacteristic integrin expression leads to abnormal cell/ECM signaling, altering the growth ... ganglia (DRG) might diffuse into the CSF, triggering the production of more TNF-α in other brain regions including the hippocampus, thus leading to aggravated neuropathic pain TNF-α may act by...
- 136
- 600
- 0
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2 Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) were used to detect ... transcription was performed using RT-PCR kit (Stratagene, La Jolla, CA, USA), following by PCR amplification as described in our paper [22] The primers with the sequence 3’-GAGGAGACAGTCCTACTGAAA (API1) ... an important physiological role for normal cell development and tissue homeostasis Dysregulation of apoptosis has been implicated in carcinogenesis, tumor progression and resistance of tumor cells...
- 6
- 514
- 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... cDNA by using the termoscript RT-PCR system (Gibco) according to the recommended protocol The CD1d gene was amplified by PCR using the following primers: 5¢-GGGCACTC AGCCAGGGGACATCCTGCCCAA-3¢ as forward ... specific primers: 5¢-CCATGGAGAAGGCTGGGG-3¢ as forward and 5¢-CA AAGTTGTCATGGATGACC-3¢ as reverse FEBS Journal 272 (2005) 152–165 ª 2004 FEBS M Cabrita et al Immunocytochemistry and immunofluorescence ... Fe) iron Statistically significant differences (Student¢s t-test) are indicated (B) Histograms show the percentage of apoptotic cells (subG0 ⁄ G1 ), and cells into the G1 and S + G2 ⁄ M phases...
- 14
- 682
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... the eight amino acid substitutions described for PTI-1 (Ala65Met, Glu66Gln, Arg67Ser, Lys100Gln, Arg247Gly, Ala281Gly and Arg423Cys, respectively) Moreover, clear MH+ signals, corresponding to ... Oncogene) for h, at room temperature, followed by incubation for h with a goat anti-mouse IgM-conjugated horseradish peroxidase secondary antibody (Sigma Chemical Co.) The blot was developed by ... corresponding to eEF1A (see Fig 10), once more indicating that normal eEF1A did not react with the GT oligomer Fig 10 Comparative analysis of bidimensional PAGE, SouthWestern and Western blotting for...
- 12
- 552
- 0
Tài liệu Báo cáo khoa học: Insulin/protein kinase B signalling pathway upregulates metastasis-related phenotypes and molecules in H7721 human hepatocarcinoma cell line pptx
... containing sense or antisense cDNA of PKB-a was performed in our laboratory as published previously [26] Briefly, the pSGS-PKBGAG (6.5 kb) was digested with EcoRI and BglII to form a 2.6kb fragment ... (paramyosin fused to GSK-3a/b crosstide corresponding to residues surrounding Ser21/9 of GSK-3a/b, CGPKGPGRRGRRRTSSFAEG) After incubation at 30 °C for 60 min, the phosphorylated GSK3a/b fusion protein ... blotting and detected by using phospho-GSK-3a/b (Ser21/9) antibody and ECL reagents Finally, the intensity of the GSK bands on X-ray film was quantified by densitometric scanning Statistical analysis...
- 11
- 615
- 0
Báo cáo khoa học: Measuring enzyme activities under standardized in vivo-like conditions for systems biology pdf
... underlying biochemistry is ham754 pered too often by the fact that kinetic parameters have been measured under nonphysiological conditions Historically, this is quite understandable, as most enzymology ... through HXK equalled the glucose flux Fluxes through PGI, PFK and ALD were calculated by dividing the sum of the glycerol and ethanol fluxes by two The flux through TPI was calculated by subtracting ... point for standardization in the Vertical Genomics Consortium [50,51] The high-phosphate medium concentration had a significantly negative effect on the enzymes phosphoglucose isomerase (PGI; EC...
- 12
- 382
- 0
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
... GAL1, GAL10, GCY1, GAL2 and GAL7 showed a high degree of SWI ⁄ SNF dependence for induction by galactose (Fig 1) GAL80 and GAL3 did not show significant SWI ⁄ SNF dependence, nor did PGM2, which was ... GAL2 and GAL7 promoters within 30 of galactose induction It is noteworthy that the GAL1 and GAL10 genes are divergent genes regulated by a common regulatory region SWI ⁄ SNF recruitment to GCY1 did ... selected genes under identical galactose induction conditions A schematic of the investigated GAL promoter regions is shown in Fig 2A Figure 2B shows that SWI ⁄ SNF is recruited to the GAL1-10, GAL2...
- 9
- 539
- 0
Báo cáo khoa học: In vivo RNA interference in oyster – vasa silencing inhibits germ cell development pptx
... genes (forward, 5¢-GTGGCTTGTGGGCTTATTGT-3¢; reverse, 5¢-CTGAAATCCGAATGGACGAC-3¢) The calculation of relative mRNA levels of target genes was based on the the comparative Ct method (see [16] for ... phenotype, germ cells developed no further OI CT AtO Gt CT OI og H og og g ApO RGt G H VO A C B CT spz Gt spd D RGt G spc spc spg E CT F Fig Effects of in vivo oyvl-dsRNA injection on germ cell ... function in female gametogenesis but not in male gametogenesis In the mouse, however, the Mvh gene appeared to be necessary for spermatogenesis completion but not for oogenesis In oysters, we...
- 8
- 406
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ