ic as a diagnostic tool to evaluate the grading of limbal stem cell deficiency lscd
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt
... at the same time during the day After the stabilization of the animals in o a warm box at 37 C for 15 min, the tail systolic blood pressure was measured with a non-invasive blood pressure system ... is a major risk factor for cardiovascular diseases such as heart failure, stroke, coronary artery disease, and myocardial infarction [12] It is called the ‘silent killer’ for good reason: Almost ... Kannel WB Blood pressure as a cardiovascular risk factor: prevention and treatment JAMA 1996, 275, 1571-1576 13 Kim D, Yokozawa T, Hattori M, Kadota S, Namba T Effects of aqueous extracts of Apocynum...
- 6
- 406
- 1
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... L lactis LB436 is a derivative of MG1363 containing a plasmid, pLB65, that harbours a gene coding for the temperate lactococcal bacteriophage TP901-1 integrase [21] The strain was used as the...
- 12
- 616
- 0
Vcd as a stimulating factor to increase the young learners’ time-on-task
... communication smooth And they may learn linguistic forms naturally Hence, the task-based teaching is useful in that it creates opportunities for learners to use language as a tool rather than as an ... repeat and participate in a single activity The advantages of using VCDs in English class are also clearly understood as shown in the table and chart above One of the most appreciated materials applied ... taught to learners at the same time with the assumption that language learning relates to learning formulaic expressions of language as well as learning rules of language Formulaic expressions can...
- 45
- 516
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the scales Finally, although ... statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) were combined to ... Subscale scores were well targeted to the sample indicating that this was an adequate sample of people with MS in which to examine the measurement properties of the MSRMS All indicators of reliability...
- 8
- 492
- 0
báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx
... medical equipment in the immediate vicinity of the patient Statistical analysis Sample size The effects of the two strategies will be evaluated on an intention -to- treat basis by comparing the hand ... 23:251-269 Lautenbach E: Practices to Improve Handwashing Compliance In Making healthcare safer: a critical analysis of patient safety practices Edited by: Shojania K, Duncan B, MacDonald K, Wachter ... considerably add to the general body of knowledge by evaluation of the added value of the extended strategy as compared to the state -of -the- art strategy Results from our study will allow us to draw...
- 9
- 521
- 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... 282:1458-1465 Davis DA, Taylor-Vaisey A: Translating guidelines into practice: A systematic review of theoretic concepts, practical experience and research evidence in the adoption of clinical practice ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...
- 10
- 521
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that ... They saw this source as an effective way to find out about the literature in an area, about what the current position on an issue was, and what was seen as best practice Assess Participants identified...
- 9
- 506
- 0
báo cáo khoa học: " The increasing chronicity of HIV in sub-Saharan Africa: Re-thinking “HIV as a long-wave event” in the era of widespread access to ART" pot
... Cite this article as: Nixon et al.: The increasing chronicity of HIV in subSaharan Africa: Re-thinking “HIV as a long-wave event” in the era of widespread access to ART Globalization and Health 2011 ... Hospital, Johannesburg African Journal of AIDS Research 2009, 8(1):93-106 Van As M, Myezwa H, Stewart A, Maleka D, Musenge E: The International Classification of Function Disability and Health (ICF) ... HIV-related disability ART has the potential to change HIV from a terminal disease to a chronic, albeit very serious, illness This shift toward chronicity has significant implications for health and...
- 5
- 225
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that ... They saw this source as an effective way to find out about the literature in an area, about what the current position on an issue was, and what was seen as best practice Assess Participants identified...
- 9
- 412
- 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx
... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... 282:1458-1465 Davis DA, Taylor-Vaisey A: Translating guidelines into practice: A systematic review of theoretic concepts, practical experience and research evidence in the adoption of clinical practice ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...
- 10
- 453
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
... position The CA-6000 linkage measures head position relative to the base affixed at the first thoracic vertebra Matching Lucite blocks, one attached to the headband of the CA-6000, and the other attached ... the projection of the laser light on a large screen located 6' in front of the participant The inclination of the headpiece with respect to vertical was recorded and MVC was determined separately ... that might serve as a global measure of neuromuscular function and reveal differences between normal subjects and those who respond to spinal manipulation As a first step toward this goal and as...
- 7
- 211
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... respectively in adiabatic case than baseline and it is the best result of insulation of an IDI diesel engine The indicated power increased at the adiabatic case 30% and 22.5% in part and full loads respectively...
- 20
- 643
- 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx
... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... work The Federal Ocean Acidification Research And Monitoring (FOARAM) Act of 2009 was passed as part of the Omnibus Public Land Management Act of 2009 (P.L 111-11) and signed into law on March...
- 163
- 400
- 0
The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx
... The IOF Allocator as Part of a Suite of Analytical Tools xii Internetting of Fires Is the Dynamic Pooling of Resources Enabled by C4ISR The IOF Allocator as Part of the WMT Suite of Analytical ... preventing the shooters from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the ... is at least one collateral target in every cell that there is a positive target Tanks are assigned a value of 10, and collateral targets are assigned a value equal to the negative of one tank...
- 48
- 369
- 0
báo cáo hóa học: " An exploratory study to evaluate the utility of an adapted Mother Generated Index (MGI) in assessment of postpartum quality of life in India" potx
... supervised the data collection AS collected the data with the help of a research team Data was analyzed by JN and AS RS, SS and AS drafted the manuscript All authors contributed to the final version of ... context the aim of medical care should be to narrow the gap between a patient's hope and aspirations and what actually happens Quality of life measurement methods have been seen as an advance in health ... that are not captured in the first five areas In step 2, she was asked to give herself a score out of 10 for each of these areas The average of these scores gave the primary index score (PIS) (max...
- 10
- 613
- 0
Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt
... invest in the infrastructure and to maintain their own gateways, the WAP clients also have to be configured to switch gateways to access various secure WAP applications The latter, like having to switch ... realistic networks using real WAP traffic Also, since WAP 2.0 has been newly released, there has not been any comparison of the performance of WAP 2.0 stack against WAP 1.x stack in the literature ... configurations are evaluated by comparing the ATDiffs, which are the WATs of other configurations minus the WAT of uncompressed WAP 2.0 ATDiff = ATotherconf − ATnocomp WAP = WATotherconf − WATnocomp WAP 3.3...
- 10
- 432
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative ... 21:434-439 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile ... Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number...
- 7
- 384
- 0
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx
... significant (p = ns) We faced problems using Caspase-3 to evaluate the apoptotic index, as this terminal enzyme of the apoptotic cascade is cytoplasmic in location This led to a diffuse staining of ... statistically Non-parametric tests were applied to assess the other variables Patient baseline characteristics, the treatment regimen, and molecular markers were each assessed for an association ... to travel great distances to seek medical care We chose to evaluate three biomarkers, namely Ki-67 (marker of proliferation), Bcl-2 and Caspase-3 (anti- and pro-apoptotic markers) as data exist...
- 11
- 393
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... proteases to the NPA in various diseases We used the ability of the flow cytometer to accurately detect different classes of particles, such as microspheres, based upon a physical characteristic ... metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases...
- 10
- 494
- 0
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps
... occur at nearly the same time The angular direction of a phasor indicates the phase relationship between light and activity for an individual Greater amounts of activity near the onset of circadian ... however, to compare phasor magnitudes (Figure 9) and IS values by using the same sets of activity data as estimates of circadian entrainment The distribution of the IS statistic was calculated from the ... by humans Daysimeter The Daysimeter was developed as a head-worn lightdosimeter and activity monitor to address measurements of the spectral and spatial response of the human circadian system...
- 14
- 522
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25