i i1 i2 i3 where i1 i2 and i3 are due to the 20 v 2 a and 16 v sources for i1 consider the circuit below

Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt

Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt

Ngày tải lên : 17/03/2014, 23:20
... histidine kinases may either be the consequence of a decrease in the histidine kinase activity, or, alternatively, of an increase in an intrinsic autophosphatase activity present in the BvgS and EvgS ... catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP binding site and mutations in this motif were previously shown to inactivate the protein [14] it is likely that there ... there are alternative intracellular signals which are perceived by BvgS via its PAS domain It is not known yet which stimuli are relevant for BvgS mediated regulation of virulence genes during infection...
  • 6
  • 421
  • 0
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc

Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc

Ngày tải lên : 22/03/2014, 15:21
... text-generation methods for producing health-information and patient-education material that is tailored to the personal and medical characteristics of the individual patient receiving it Information ... to later Fortunately, in such clinical situations, much of the information that is needed for tailoring health-education material is available in the patient’s medical record Indeed, a medical ... to generate an appropriate surface form in English A formatter then lays out the text attractively and adds headings and illustrations for final printing Authoring and Generating Tailored Health-Education...
  • 12
  • 379
  • 0
Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 1) pptx

Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 1) pptx

Ngày tải lên : 08/07/2014, 02:20
... prosthetic valves This organism most frequently affects the aortic valve Many patients have signs and symptoms of long-standing infection before diagnosis, with evidence of arterial embolization, vasculitis, ... tract infection, pneumonia, and empyema, among other infections Cardiobacterium hominis C hominis primarily causes endocarditis in patients with underlying valvular heart disease or with prosthetic ... species isolated from cases of HACEK endocarditis; H paraphrophilus is less common Invasive infection typically occurs in patients with a history of cardiac valvular disease, often in the setting...
  • 5
  • 320
  • 0
Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 2) ppsx

Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 2) ppsx

Ngày tải lên : 08/07/2014, 02:20
... Endocarditis Caused by HACEK Group Organismsa Organism Initial Alternative Agents Therapy Haemophilus species, ts Ceftriaxo ne (2 g/d) Commen Ampicillin/sulbact Ampicill am (3 g of ampicillin in Actinobacillus ... cerebrovascular accidents, tricuspid insufficiency, and congestive heart failure with cardiovascular collapse Endocarditis Caused by HACEK Organisms: Treatment See Table 140-1 Native-valve endocarditis ... endocarditis should be treated for weeks with antibiotics, whereas prosthetic-valve endocarditis requires weeks of therapy The cure rates for HACEK prosthetic-valve endocarditis appear to be high Unlike...
  • 5
  • 302
  • 0
Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 3) pot

Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 3) pot

Ngày tải lên : 08/07/2014, 02:20
... infections are caused by A hydrophila, A caviae, and A veronii biovar sobria Aeromonas proliferates in potable and fresh water and in soil It remains controversial whether Aeromonas is a cause of bacterial ... infections, including severe sepsis with shock and disseminated intravascular coagulation, meningitis, endocarditis, cellulitis, and septic arthritis Capnocytophaga Infections: Treatment Because of increasing ... or hepatobiliary disease Aeromonas infection and sepsis can occur in patients with trauma (including severe trauma with myonecrosis) and in burn patients exposed to Aeromonas by environmental (freshwater...
  • 5
  • 262
  • 0
Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 4) docx

Chapter 140. Infections Due to the HACEK Group and Miscellaneous Gram-Negative Bacteria (Part 4) docx

Ngày tải lên : 08/07/2014, 02:20
... multocida is a bipolar-staining, gram-negative coccobacillus that colonizes the respiratory and gastrointestinal tracts of domestic animals; oropharyngeal colonization rates are 70–90% in cats and ... consensus guidelines from the Clinical and Laboratory Standards Institute for antimicrobial susceptibility testing of infrequently isolated or fastidious bacteria Ciln Infect Dis 44 :28 0, 20 0 7 Kaiser ... but cases have also occurred in healthy individuals If inhaled, P multocida can cause acute respiratory tract infection, particularly in patients with underlying sinus and pulmonary disease Pasteurella...
  • 8
  • 330
  • 0
Báo cáo y học: " Treatment of stasis dermatitis using aminaphtone: solated angioedema of the bowel due to C1 esterase inhibitor deficiency: a case report and review of literature" pot

Báo cáo y học: " Treatment of stasis dermatitis using aminaphtone: solated angioedema of the bowel due to C1 esterase inhibitor deficiency: a case report and review of literature" pot

Ngày tải lên : 11/08/2014, 00:22
... cleavage of C2 and C4 It also inhibits the ability of plasmin to activate C1 and to generate bradykinin from C2 Other protease inhibitors such as antithrombin III, b2macroglobulin, a1 -antitrypsin ... irregularities and intramural edema of the distal ileum Our patient was hospitalized and treated with intravenous hydration He was afebrile at this time Laboratory investigations revealed that his ... Yersinia, ova and parasite, and standard culture Levels of prostate specific antigen, carcinoembryonic antigen, anti-neutrophil cytoplasmic antibody, antiSaccharomyces cerevisiae antibody, methemoglobin...
  • 6
  • 376
  • 0
Báo cáo y học: " Multifocal multi-organ ischaemia and infarction in a preterm baby due to maternal intravenous cocaine use: a case report" pptx

Báo cáo y học: " Multifocal multi-organ ischaemia and infarction in a preterm baby due to maternal intravenous cocaine use: a case report" pptx

Ngày tải lên : 11/08/2014, 14:21
... need for further prospective research in this area with dosage and mode of administration being considered as confounding factors Abbreviations ALT, alanine transaminase; APTT, activated partial ... ‘crack babies’ could have a variety of congenital abnormalities, including gastroschisis, intraventricular haemorrhage, growth restriction, and genitourinary and renal anomalies [4] While evidence ... ultrasound at 36 hours of age showed bilateral intraventricular blood with evidence of marked midline shift It was decided that continuing care aimed at the baby’s survival was inappropriate and...
  • 4
  • 269
  • 0
Báo cáo y học: " Multifocal multi-organ ischaemia and infarction in a preterm baby due to maternal intravenous cocaine use: a case report" ppsx

Báo cáo y học: " Multifocal multi-organ ischaemia and infarction in a preterm baby due to maternal intravenous cocaine use: a case report" ppsx

Ngày tải lên : 11/08/2014, 14:21
... of marked midline shift It was decided that continuing care aimed at the baby's survival was inappropriate and care was re-orientated following discussion with the baby's mother The infant was ... dosage and mode of administration being considered as confounding factors Abbreviations ALT: alanine transaminase; APTT: activated partial thromboplastin time; AST: aspartate transaminase; BP: blood ... and We advocate early and regular coagulation screening and cranial ultrasound scans for pregnant women with significant cocaine use, particularly if taken intravenously The risk of significant...
  • 4
  • 314
  • 0
Báo cáo y học: "Quantification of the glycogen cascade system: the ultrasensitive responses of liver glycogen synthase and muscle phosphorylase are due to distinctive regulatory designs" pptx

Báo cáo y học: "Quantification of the glycogen cascade system: the ultrasensitive responses of liver glycogen synthase and muscle phosphorylase are due to distinctive regulatory designs" pptx

Ngày tải lên : 13/08/2014, 22:22
... performed the sensitivity analysis on the complete data set To assess the sensitivity to variations in individual parameters, each parameter was varied over a 10fold while holding all the other parameters ... experiments VKM and KVV analyzed the data VKM and KVV conceptualized the manuscript All authors have read and approved the final manuscript 11 R2C2 + 2cAMP ← R2C(cAMP )2 + C → K 22 R2C(cAMP )2 + 2cAMP ... signs indicate the activation and inhibition of a reaction respectively In the muscle (Fig 1A) , cAMP activated CAPK catalyzes the phosphorylation of GS, PK and inhibitor-1 Phosphorylated PK activates...
  • 18
  • 242
  • 0
Integrated analysis of audiovisual signals and external information sources for event detection in team sports video

Integrated analysis of audiovisual signals and external information sources for event detection in team sports video

Ngày tải lên : 12/09/2015, 08:19
... Zimmermann, and Dr Changsheng Xu Having stayed in the Multimedia Information Lab II for so many years, I am obliged to labmates and friends for giving me their support and for making my hours in the ... challenge in the integrated analysis is the asynchronism between the audiovisual signals and the external information sources as two separate information sources Another motivation of this work is that ... between the audiovisual signals and external information sources was the central issue in designing both frameworks In the late fusion framework, the audiovisual signals and external information sources...
  • 164
  • 397
  • 0
Part i organic reactions in non conventional solvents part II new approach to the formation of bishomoallylic alcohols   synthesis of (r) sulcatol

Part i organic reactions in non conventional solvents part II new approach to the formation of bishomoallylic alcohols synthesis of (r) sulcatol

Ngày tải lên : 16/09/2015, 15:54
... Falicain Be -22 54 (anaesthetic) (anti-hypertensive) Figure Application of Mannich bases and their derivatives in medicine Hence, the versatility of the Mannich reaction, along with the remarkable ... enantioselectivities in the synthesis of β-amino ester derivatives have been achieved using small amount of N-methylimidazole (NMI) additive The zirconium catalyst was effective for the catalytic activation ... tuned to optimize yield, selectivity, substrate solubility, product separation, and even enantioselectivity (8) While very little toxicity data are available, it would appear that many ionic liquids...
  • 228
  • 366
  • 0
Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf

Ngày tải lên : 16/02/2014, 03:20
... http://publicaa.ansi.org/sites/apdl/Documents/Standards %20 Activities/American %20 National %20 Standards/Procedures, %20 Guides, %2 0and% 20 Forms/ 20 1 0 %20 ANSI %20 Essential %20 Requirements %2 0and% 20 Related /20 1 0 %20 ANSI %20 Essential %20 Requirements.pdf ... certifications, and, as of 20 0 9, certificates, is the American National Standards Institute ANSI provides a process for evaluating requirements within a standard The standard associated with certifications ... organizations and, since 20 0 9, educational certificate programs based on American National Standards or ISO International Standards To date, ANSI has accredited 30 certification bodies, and is in...
  • 46
  • 477
  • 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Ngày tải lên : 20/02/2014, 11:20
... evidence has been obtained that the binding sites on the I domains for different ligands are overlapping but not identical [18 22 ] Integrins need divalent cations for their activity, and they have been ... Nikkila, Tuula ¨ ¨ Nurminen and Saija Makinen for excellent technical assistance, and ¨ Yvonne Heinila for secretarial work We also want to thank Erkki ¨ Koivunen and Tanja-Maria Ranta for providing ... (Figs and 7) The CD1 1a I domain specific TS1 /22 mAb efficiently inhibited the binding of ICAM-1 and -2 transfected L cells to the I domain of CD1 1a, and partially but significantly inhibited the interaction...
  • 14
  • 495
  • 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Ngày tải lên : 07/03/2014, 09:20
... rabbit, rat and human are available and revealed structural identity with the structure of Cd5Zn2MT -2 [8] Comparative NMR studies provided evidence that Zn(II) can isomorphically replace Cd(II) in ... domains demonstrated that up to six Cu (I) ions can bind to each domain [26 ] In another extensive titration study, it was postulated that zinc was required for the in vivo and in vitro folding ... stoichiometries higher than five Taken together, the initial additions of Cu (I) to each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another...
  • 14
  • 485
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP _2: AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP _2: ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP _2: AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP _2: ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT...
  • 12
  • 772
  • 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx

Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx

Ngày tải lên : 08/03/2014, 22:20
... tested above was not investigated However, both the Akt (via IRS-1) and the MAP kinase (via Shc) pathways are involved in IGF-induced antiapoptotic signalling via the IGF1R in PC 12 cells [20 ] It ... rate and kd is the dissociation rate Relative Kd is equal to Kd of IGF -I/ Kd of IGF analogue Dashes indicate data inappropriate for assessing association and dissociation rates No detectable binding ... established the relative binding af®nities of IGF -I, IGF-II and the 14 analogues for rhIGF1R, we related these to their abilities to prevent apoptosis IGFs have powerful antiapoptotic effects and...
  • 8
  • 482
  • 0
Báo cáo khoa học: Recruitment of coregulator complexes to the b-globin gene locus by TFII-I and upstream stimulatory factor doc

Báo cáo khoa học: Recruitment of coregulator complexes to the b-globin gene locus by TFII-I and upstream stimulatory factor doc

Ngày tải lên : 23/03/2014, 07:20
... region reveals additive activity of the DNaseI hypersensitive sites Blood 98, 20 2 2 20 2 7 13 Marenduzzo D, Faro-Trindade I & Cook PR (20 0 7) What are the molecular ties that maintain genomic loops? ... manufacturer’s instructions (Amersham Pharmacia Biotech, Piscataway, NJ, USA) The primary antibodies used were the same as those used in the ChIP and immunoprecipitation assays in addition to HDAC3 (H-99) ... have been characterized in detail GATA-1, EKLF and NF-E2 are hematopoietic transcription factors that have all been shown to participate in LCR function and b-globin gene expression [6] In addition...
  • 9
  • 312
  • 0
PROGRESS I N BRAIN RESEARCH VOLUME 36 BIOCHEMICAL AND PHARMACOLOGICAL MECHANISMS UNDERLYING BEHAVIOUR doc

PROGRESS I N BRAIN RESEARCH VOLUME 36 BIOCHEMICAL AND PHARMACOLOGICAL MECHANISMS UNDERLYING BEHAVIOUR doc

Ngày tải lên : 29/03/2014, 13:20
... Gadsby, for making facilities available for this Symposium and to the staff of the Establishment for their assistance with the organization Thanks are also due to Miss Sally Clements for helping ... these seems likely to yield valuable information concerning the biochemical and physiological systems which are involved in both normal behaviour, and abnormal behaviour as manifested in various ... normal behaviour is determined To reveal the basic malfunctions which manifest as mental disease, and hence assist in the evolution of rational approaches to therapy To allow the identification...
  • 217
  • 262
  • 0

Xem thêm