hơn 1000 năm đấu tranh giành độc lập tổ tiên đã để lại cho chúng ta
Báo cáo y học: "Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element" ppt
... SV40+ 5′-ctgactaattttttttatttatgc-3′, reverse: SDR_AflII 5′-gaattccttaagccttaaacctgtcttgtaacc-3′) and then the amplification of the SA sequence (forward: SAF_XhoI 5′-gaattcctcgagagaccaatagaaactgggc-3′, ... T G C C 13571377 AAATATACATCGTTTCCATGG 33 - 62% match ADAM metallopeptidase A domain 12 (ADAM12) transcript1 - 76% match chromosome 11 genomic contig2 T T T 13581378 AATATACATCGTTTCCATGGC 42 ... TCGTCCTCTCGCGGAAATATACA 52 - 66% match oligophrenin (OPHN1) transcript1 - 71% chromosome 16 open reading frame 352 G C G A [41] siRNA target 1346designer 1364 GTCCTCTCGCGGAAATATA 47 - 73% match...
- 10
- 372
- 0
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx
... clusters Tag sequence UniGene ID Abundance A B C D E 10 ACTTACCTGC GCGTGCCTGC GCCCCTGCGC GTGACCACGG GTGGCACACG AACGAGGAAT GTAAGTGTAC AGAGGTGTAG TTGCCAACAC GAAGTCGGAA GCCGTTCTTA ATTAAGAGGG ATGCCTGTAG ... analysis of 16 tags Lanes 1–11 were unknown SAGE tags corresponding to tags 1–11 in Table Lanes a, b, c, d and e were known SAGE tags corresponding to tags A, B, C, D and E in Table TSAT-PCR ... chose five tags corresponding to known genes, as well as 11 differentabundance tags corresponding to unknown genes, all identified in SAGE analysis of human spermatozoa (Table 1) Among the 16 tags,...
- 7
- 529
- 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf
... housekeeping genes for the normalisation of QPCR data in certain experimental settings [4-7,14,15] Careful consideration must therefore be carried out when choosing appropriate reference genes in QPCR ... 77(8):4950-4959 Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 2001, 25(4):402-408 Publish with Bio Med Central ... can be variable under several experimental conditions, making them inappropriate for use as normalisers [4-7] In reality no cellular gene maintains constant expression levels under all conditions...
- 5
- 481
- 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot
... housekeeping genes for the normalisation of QPCR data in certain experimental settings [4-7,14,15] Careful consideration must therefore be carried out when choosing appropriate reference genes in QPCR ... 77(8):4950-4959 Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 2001, 25(4):402-408 Publish with Bio Med Central ... can be variable under several experimental conditions, making them inappropriate for use as normalisers [4-7] In reality no cellular gene maintains constant expression levels under all conditions...
- 5
- 574
- 0
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx
... carriers Infect Genet Evol 2008, 8(3):306-12 Utama A, Octavia TI, Dhenni R, Miskad UA, Yusuf I, Tai S: Hepatitis B virus genotypes/subgenotypes in voluntary blood donors in Makassar, South Sulawesi, ... anti-HBe sera Table shows the HBe Ag status and the PCR amplification results in the studied population PCR-RFLP and TSP-PCR were successfully assessed for the 130 samples with detectable HBV DNA ... http://www.virologyj.com/content/7/1/302 Page of Table Clinical status, subgenotype and genotype of HBV strains according to the genotyping method Genotype determined using Sample Clinical status PCR- TSP- Sequencing...
- 6
- 412
- 0
Tài liệu PCR-RFLP ANALYSIS OF BETA-LACTOGLOBULIN GENE IN MURRAH BUFFALOES pdf
... buffaloes maintained at Central cattle breeding farm, Alamadi, Tamilnadu Individual blood samples of ml each were collected from 110 Murrah buffaloes using ml vacuitainer tubes containing EDTA from ... b-lg gene in Murrah buffaloes Genomic DNA Isolation Blood samples collected in a vacuitainer containing EDTA were transferred to a 15 ml centrifuge tube and centrifuged at 4000 rpm for 10 and ... 5’ – CAGGACACCGGCTCCTGGTATATGA-3’ Reactions were carried out in 100ml volume The reaction conditions and reagent concentrations were:100pmole of each primer,2.5 units of Taq.DNA polymerase,1X...
- 4
- 568
- 0
Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc
... 3¢anchored oligo(dT) primers: 5¢biotin-ATCTAGAGCGGCCGC-T16 VN-3¢, where N = A, C, G or T, and V = A, G or C Linker A: 5¢-TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGACATG-3¢ and 5¢-pTCCCT ATTAA GCCTAGTTGTACTGCACCAGCAAATCC-amino ... 5¢-CCAGACACTATGCTCATACGACG-3¢ Tag-specific primer: 5¢-GGATCCCATGXXXXXXXXXX-3¢, where GGATCC is the BamHI site, and CATG(X)10 is the tag UP-I: 5¢-CCAGACACTATGCTCATA-3¢ UP-II: 5¢-CACTATGCTCATACGACGCAGT-3¢ ... PLF and PLR and Takara Ex Taq Hot Start Step PCR amplification with tag-specific primer (Ptag) and UP-I Make several dilutions of the amplified full-length cDNAs above: lL of a ⁄ 1000 dilution is...
- 12
- 544
- 0
Báo cáo khoa học: "Analysis of Salmonella enterica serotype Enteritidis isolated from human and chickens by repetitive sequence-PCR fingerprinting, antibiotic resistance and plasmid profiles" ppsx
... deniatnoc yletamixorppa etalosi hcaE )nwohs ton atad( snekcihc morf esoht htiw snrettap emas eht detneserper osla skaerbtuo namuh morf setalosi evlewT )40CS( etalosi eno tpecxe snrettap emas eht ... gninosiop-doof eht taht dedulcnoc eb dluoc ,revewoh ,tI etalosi siht no atad lacigoloimedipe no noitamrofni on evah ,yletanutrofnu ,eW nrettap dnab AND tnereffid a dewohs dna nekcihc morf detanigiro saw ... ,)'3-C ACT TAG GGG TCC TCG AAT GTA-'5( R1CIRE dedulcni sremirP esu litnu Co02− ta derots dna AND sa desu saw tnatanrepus ehT g × 000,8 ta degufirtnec dna ,nim rof deliob erew yehT retaw dellitsid...
- 5
- 211
- 0
Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx
... the standard curve method The CEs were determined based on the PBMC reference standard Table presents the CEs of GAPDH, IL-1β, IL-6 and MMP-1 with the standard deviation and percentage CV obtained ... serially diluted to establish standards containing cDNA from the equivalent of 24–100,000 cells Standard curves were determined for IL-1β, IL-6, TNF-α, MMP-1, and GAPDH using TaqMan chemistry and ... Note that the percentage coefficient of variation was greater for the C(t) method compared with that for the standard curve method Table Table Intra-assay variation for quantitative PCR Assessment...
- 9
- 557
- 0
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
... containing 1× Ex Taq Buffer (Takara Ex taq, Otsu, Shiga, Japan), 0.2 mmol/l of each primer, 2.5 mmol/l of each DNTP, mmol/l MgCl2 and 1.25 units of Takara Ex Taq DNA polymerase (Takara Ex taq, ... samples were taken from the knee joint using the ParkerPearson biopsy procedure [27] Care was taken during and after obtaining patient samples to prevent cutaneous bacterial contamination The ... ribosomal database project II software [34] Stastistical analysis Data were compared by Fisher's exact test using Epi Info software, version 6.04a (Centers for Disease Control and Prevention, Atlanta,...
- 14
- 500
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... availability of choline is probably more important for the accumulation of glycinebetaine than the amount of the enzymes catalysing the conversion of choline to glycinebetaine, i.e choline monoxygenase ... into phosphatidylcholine and then metabolized to choline [93] (Fig 2) Primarily the synthesis of choline occurs following the route phospho-ethanolamine (P-EA) to phospho-choline, P-choline (bold ... adaptation of plants to saline condition and possibly vital for the salt adaptive physiological processes Other details as in Table aPercentage of the fraction of ESTs representing a unigene/total...
- 25
- 292
- 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... F, Schalm SW, Tiollais P, Brechot C: Comparison of a quantitative standardized HBV-DNA assay and a Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online ... COBAS TaqMan Test on 94 randomly selected samples with Hepatitis B Ultra sensitive RTQ-PCR COBAS TaqMan Test + (n %) - (n %) Total 83 (88.3%) (6.4%) 89 (94.7%) - (2.1%) (3.2%) (5.3%) Total 85 ... Health & Welfare 15 16 Author details Department of Hygiene Epidemiology and Medical Statistics, Medical School, University of Athens, Athens, Greece 2Laikon General Hospital, 2nd Blood Transfusion...
- 6
- 536
- 1
Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt
... GU816103 gatataagtgctgtcatatagtaaatgcctaaataaaagtgttttgtgta gatataagtgctgtcatatagtaaatacctaaataaaagtgttttgtgta ************************** *********************** EU981808 GU816103 gttttaatttatattctatttttcagaaacacaactaccatataaactga ... gttttaatttatattctatttttcagaaacacaactaccatataaactga gttttaatttatattctatttttcagaaacacaactaccatataaactga ************************************************** EU981808 GU816103 gagagtatttttatttctttgggattttacaaagagcaatttaccatttt ... CTCCTCAGAGTGATTGACTACCCAGCTCGGGGGTCTTTCAatatgtttgg CTCCTCAGAGTAATTAACTACCCAGCTCGGGGGTCTTTCAatatgtttgg *********** *** ********************************** EU981810 EU981678 ttaacacccttatcg ttaacanccttatcg...
- 3
- 209
- 0
Báo cáo y học: "Base relative quantification framework and software for management and automated analysis of real-time quantitative PCR data" potx
... 28.95 Volume 8, Issue 2, Article R19 comment Sample Standard1 Standard1 Standard2 Standard2 Standard3 Standard3 Standard4 Standard4 Standard5 Standard5 Genome Biology 2007, R19.4 Genome Biology ... version of this paper Additional data file contains all the data and calculations leading to the results presented in Figure Additional data file contains all the data and calculations that were used ... the exchange of qPCR data under the form of XML files [15] Data can be imported from a number of data formats Two standards (qBase internal format and RDML (Real-time PCR Data Markup Language))...
- 14
- 583
- 0
Static and Dynamic Analysis of Space frames
... installing any application Existing RM2000/GP20000 installation should be uninstalled and replaced by the Basic installation and the single installation of RM2000 and GP2000 Please always uninstall ... export most of the important input data prepared for a project using RM7 into the RM2000 database directly The RM7 project directory must be opened before starting the data transfer and a SYSAK ... 8.25.04 3.113.1 RM2000 Database conversion This release contains a new database The user can no longer access old projects stored in RMDATA##.RM8 with the new release The new database is stored in...
- 19
- 633
- 0
Static and Dynamic Analysis of Spaceframes
... Loadsets & Loadcases already defined) LoadInfo G1 I 100 G2 200 G3 PT C&S 300 500 600 II 1000 1000 1000 1000 1000 Description Selfweight Additional permanent load Additional permanent load Prestressing ... in each stage (e.g.: in Stage all the elements that are constructed in stage etc.) Add all the actions required in the different stages (e.g.: Calculation action of loading case 101 in Stage etc… ... the associated documentation are proprietary and copyrighted products Ownership of the program and the documentation remain with TDV Austria Use of the program and the documentation is restricted...
- 34
- 1,125
- 1
Static and Dynamic Analysis of Spaceframes
... Copying Standard Data to the Project Database 1.1.4.1 General The function "FILE #DEFAULTS is used to copy standard data into the Project Database The data source may be the Standard Database in ... for changing, deleting or adding data in the Standard Database If the data in the Standard Database must be changed, the user can either delete the Standard Database and make a new initial setup, ... PROGRAM DATA FILE STRUCTURE 1-1 Program Data 1-1 Project Data 1-2 Setup of a Standard Database 1-5 Copying Standard Data to the Project Database...
- 484
- 1,189
- 1
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"
... data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis MK contributed to study concept and design, to analysis and interpretation of data ... interpretation of data and to drafting of the manuscript and critical revision for important intellectual content CG contributed to study concept and design, to analysis and interpretation of data, ... intermittent and prolonged infusions of piperacillin/tazobactam using Monte Carlo simulations and steady-state pharmacokinetic data from hospitalized patients Ann Pharmacother 2009, 43:1747-1754...
- 10
- 557
- 1
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
... impaired after the AMI M-Mode and B-Mode transthoracic echocardiographic diameters and volumes are displayed in Table Table 2: Echocardiographic data set Ejection fraction, EF (%) IVSD (cm) HWD (cm) ... previously published data of parametric echocardiography, already clinically integrated and established 15 Limitations Based on 2D gray scale images the quality of VVI data is strictly dependent ... data are listed in Table Table 1: Basic clinical characteristics Gender (male/female) Age (years) Height (cm) Weight (kg) BMI (kg/m2) ECG (STEMI/NSTEMI) 27/5 58 ± 12 1.72 ± 81 ± 15 27 ± 23/9 Echocardiography...
- 8
- 683
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... assuming the participant did not fully understand the question Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated ... p-value t p-value 41.3 Total 730 According to Table 2, the presence of disease was statistically greater (χ2=16.00, df=1, p
- 12
- 757
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25