hydrolysis of the salt of a weak acid and a weak base
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
Ngày tải lên :
15/01/2014, 15:59
... clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed ... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... surveys is their tendency to show a high level of satisfaction, a lack of standard satisfaction scales and the proliferation and excessive use of surveys (Altany, 1993; Mehta, 1990) Additional problems...
- 37
- 1.1K
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
Ngày tải lên :
28/03/2014, 21:20
... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text-based replication of site navigation bar at the top of each page to make scrolling ... appropriateness of graphics and icons, clarity and quality of information, suitability of external links, and clarity and perceived motivating and discussion promoting characteristics of the learning ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student...
- 12
- 411
- 0
báo cáo hóa học: " Doubtful outcome of the validation of the Rome II questionnaire: validation of a symptom based diagnostic tool" doc
Ngày tải lên :
18/06/2014, 19:20
... was the mentor of LK and participated in the face validity process of the translation LK also participated in the writing of the manuscript LA had the comprehensive responsibility for the main ... Bolling-Sternevald E, Junghard O, Talley NJ, Agreus L: Gatro-oesophageal reflux symptoms and health-related quality of life in the adult general population -the Kalixanda study Aliment Pharmacol Ther 2006, ... criterion standard, were 34.2% and 95.1% for GERS, 33.8% and 92.2% for FD, and 63.3% and 87.1% for IBS The kappa values and overall agreement between the printed version and the digital version of Rome...
- 9
- 524
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
Ngày tải lên :
18/06/2014, 19:20
... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... conducted analysis and reported on the valuation exercise *DM ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed to the writing of the manuscript ... state Validation of the preference based CAMPHOR scale A majority (87.8%) of the 91 participants in the CAMPHOR validation survey were in New York Heart Association (NYHA) classes II and III The...
- 8
- 590
- 0
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
Ngày tải lên :
20/06/2014, 04:20
... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant into the ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design of the study and performed ... destruction of the ligaments, capsules and soft tissue Soft tissue was only removed from the upper half of the cranial vertebral body and the lower half of the caudal vertebral body The upper and lower...
- 9
- 457
- 0
báo cáo hóa học:" India-US collaboration to prevent adolescent HIV infection: the feasibility of a family-based HIV-prevention intervention for rural Indian youth" pot
Ngày tải lên :
20/06/2014, 08:20
... for all participants [35,40] As the pada lacked a common space, the girls and the mothers groups met in the house of the pada worker, and the boys and fathers groups met in the house of the angan- ... Guilamo-Ramos, as principal investigators, had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis The study was designed ... "They are outside and they feel it is a need so they have sexual relationships." one father said Feasibility of a family-based programme All four groups of stakeholders indicated that a familybased...
- 13
- 504
- 0
Báo cáo lâm nghiệp: "Assessment of the assortment potential of the growing stock – a photogrammetry based approach for an automatized grading of sample trees" potx
Ngày tải lên :
07/08/2014, 16:20
... of the assortment criteria for the grading routine, a database application thar-QDB (Tharandt Quality Data Base) was developed as subject-matter of a diploma thesis [19] The grading process was ... (breast height) and the basal areas of first green/dead branch can serve as “natural pass points” for supporting a rectification of the stem part > m height Finally, the geo-coordinates of the sample ... eCognition software An application example of the differences between “normal” and “improved” grading will be presented for two sample trees The data base application and the evaluation approach will...
- 10
- 359
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
Ngày tải lên :
07/08/2014, 18:21
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...
- 6
- 347
- 0
Báo cáo khoa học: "Registration accuracy for MR images of the prostate using a subvolume based registration protocol" pps
Ngày tải lên :
09/08/2014, 09:20
... delineated the contours in collaboration with KS, created software needed for the study and drafted the manuscript PB and AG aided in the creation of the registration software MK participated in the ... number of 150 MR-MR registrations Analysis We quantified the registration uncertainty as the standard deviation of the center of mass distance between the prostate gland (RV0) binary masks for each ... this is the use of intraprostatic fiducial markers The radio opaque markers are implanted into the prostate gland, and can thereafter be visualized using most imaging modalities By manually defining...
- 5
- 306
- 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
Ngày tải lên :
10/08/2014, 05:20
... reporting of at least some CD4 counts and viral loads at the time of the study and the third had an established, clinically-based HIV reporting system that had been in place and integrated with AIDS ... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory ... manuscript MD had responsibility for data management and for the analysis of the data, and participated in drafting the manuscript SEB contributed to the development of the study methods, was responsible...
- 7
- 337
- 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx
Ngày tải lên :
12/08/2014, 04:20
... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI...
- 6
- 270
- 0
Báo cáo y học: "Mortality associated with administration of highdose tranexamic acid and aprotinin in primary open-heart procedures: a retrospective analysis" ppt
Ngày tải lên :
13/08/2014, 21:21
... and ventricular septal defect repair Page of 14 Table Baseline characteristics of the patients in the aprotinin and tranexamic acid groups Aprotinin Tranexamic acid Mean SD Mean SD P 68 69 67 68 ... The leading cause of death was Sander et al Critical Care 2010, 14:R148 http://ccforum.com/content/14/4/R148 Page of 14 Table Safety data of patients receiving aprotinin and tranexamic acid Aprotinin ... the manuscript, conceived the study, and performed the statistical analysis MS, CvH, and VM carried out the data acquisition; KDW prepared the statistical part of the manuscript and performed the...
- 14
- 247
- 0
The impact of a genre-based approach on 11th students’ writing performance An action research at Tuyen Quang Gifted High School, Tuyen Quang
Ngày tải lên :
04/08/2015, 09:41
... 2 Aims and objectives of the research The research is aimed at investigating students‘ attitudes towards the genre-based approach, which was new to them, and examining whether this teaching approach ... Tuyen Quang, Vietnam The research lasted for weeks and the treatment was applied to all students in a classroom The research mainly focused on 11th form students majored in Mathematics The research ... research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approach that their teacher (also the researcher) used In addition to the...
- 5
- 548
- 6
The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province
Ngày tải lên :
04/08/2015, 09:42
... House Callaghan,M.,&Rotherry,J (1988) Teaching factural writing: A genre based approach.Marrickville,N.S.W:DSP literacy project,Metropolitan East region Chandrasegaran, A and Kum, K T (2008) Teaching ... 2.3.2.2.During the experimental treatment 25 2.3.2.3.After the experimental treatment 25-26 2.4 Data Analysis 26 2.4.1 Data Analysis of Pre -and - Post Tests 26 2.4.1.1 The two groups’ writing performance ... Nội Tiếng Anh Anderson, K & Anderson, M (1995) Text Types in English Australia: Macmillan Education Badger, R and White, G (2000) A process genre approach to teaching writing ELT Journal Volume...
- 9
- 863
- 7
A contrastive analysis of the utterances containing implicatures in english and vietnamese culture (based on utterances from funny stories)
Ngày tải lên :
07/10/2016, 08:31
... event; the setting including location, time of day, season of year, and physical aspects of the situation, the participants and the relationships between them; and the background knowledge and assumptions ... story violated the maxim of manner and relation The man asked the woman how many toes a pig had and the woman replied by asking the man to count his toes The man thought that the woman knew nothing ... sarcastically asked The wife implicated her husband was an animal However, the husband was also smart; he could not yield to his wife and answered “In-law” to implicate that the wife was a real...
- 65
- 985
- 1
Tài liệu Effect of a school-based oral health education programme in Wuhan City, Peoples Republic of China ppt
Ngày tải lên :
14/02/2014, 13:20
... Periodontal Index probes18 Prior to the study, the examiners were calibrated against a master examiner The kappa statistic was used to assess the inter-examiner reliability of caries and the final kappa ... took place prior to the programme (August 1998) Training was in the value of teeth and general health, diet and nutrition, oral anatomy and tooth development, causes and prevention of dental caries ... children, and oral health knowledge, attitudes and behaviour of mothers In addition, levels of oral health knowledge and attitudes of teachers and their involvement in oral health education were measured...
- 9
- 587
- 0
Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc
Ngày tải lên :
21/02/2014, 20:20
... requirements of the report generator Research in machine translations and text understanding9 has demonstrated that not only does naturally generated text disclose the lexicon and grammar of a sublanguage, ... but it also reveals the essential semantic classes and attributes of a domain of discourse, as well as the relations between those classes and attributes Thus, samples of actual text may be used ... Semantic analysis of a sample of natural text stock reports discloses that a hierarchy of approximately forty message classes accounts for nearly all of the semantic information contained in the...
- 6
- 452
- 0
Báo cáo khoa học: Reconstruction ofde novopathway for synthesis of UDP-glucuronic acid and UDP-xylose from intrinsic UDP-glucose inSaccharomyces cerevisiae pptx
Ngày tải lên :
07/03/2014, 12:20
... (5¢-AAAAAGTCGACTCATGCC ACAGCAGGCATATCCTT-3¢); for UGD1-His, UGD1His-EcoRI-F (5¢-AGAATTCATGCATCACCATCACCAT CACATGGTGAAGATATGCTGCATAG-3¢) and UGD1SalI-R, UXS3-EcoRI-F (5¢-AGATTCATGGCAGCTACA AGTGAGAAACAGA-3¢); and ... using the following oligonucleotide primers: for UGD-VSV-G, UGD1-VSV-G-EcoRI-F (5¢-AGAATTCATGTATACTGATATTGAAATGAATAG ATTGGGTAAAATGGTGAAGATATGCTGCATAGGA G-3¢) and UGD1-SalI-R (5¢-AAAAAGTCGACTCATGCC ... UDP-sugars make up approximately 40–50% of the wall polysaccharide mass However, the yeast cell wall consists mostly of b-glucan, a- mannan and chitin, and there are no synthetic or breakdown pathways...
- 13
- 541
- 0
Báo cáo Y học: Concerted regulation of free arachidonic acid and hormone-induced steroid synthesis by acyl-CoA thioesterases and acyl-CoA synthetases in adrenal cells pdf
Ngày tải lên :
08/03/2014, 09:20
... demonstrate that recombinant MTE-I and CTE-I release AA from arachidonoyl-CoA in vitro and that ACTH increases the activity of the endogenous enzyme and promotes AA release from AA-CoA ACTH-stimulated ... by-passes the effect of the inhibitors strongly indicates that the thioesterase and the acyl CoA-synthetase act in the same signalling pathway in a step prior to the rate-limiting passage of cholesterol ... ACTH and suppressed by glucocorticoids [40] Here, we address the question of whether AA-CoA, acylCoA synthetase and thioesterase are, indeed, essential for AA release and adrenal cholesterol metabolism...
- 9
- 470
- 0
Báo cáo khoa học: Hydrolysis of acetylthiocoline, o-nitroacetanilide and o-nitrotrifluoroacetanilide by fetal bovine serum acetylcholinesterase doc
Ngày tải lên :
16/03/2014, 01:20
... Boehringer Mannheim (Germany), and the monoclonal antibody HR2 against human brain AChE was provided by Affinity Bioreagents (Golden, CO, USA) Purification of AChE and assay of esterase and amidase activities ... of catalytic sites was 70 ± 10 nM, and in assays with F-ONA and ONA it was 1540 nM The much lower hydrolysis rate of nitroacetanilides than of ATCh makes it necessary to raise the amount of AChE ... esterase (ATCh) and amidase (F-ONA and 2076 ONA) substrates are given in Table The results show that fetal bovine serum AChE displays a lower Km value with ATCh than with F-ONA and ONA, a trait also...
- 10
- 407
- 0