hsct has a protective effect

Báo cáo khoa học: Deﬁciency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Ngày tải lên : 05/03/2014, 23:20

... containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central ... Our data show that the hypercholesterolemia of apoE) ⁄ ) mice is not a causative factor in diet-induced NAFLD in these mice Rather, our results have established that apoE deﬁciency has a protective ... had a much lower steady-state plasma FFA concentration of 1.4 ± 0.1 mmol eq.; P < 0.005) Despite this apparent increase in lipoprotein lipase-mediated FFA production and in steady-state plasma...

11
544
0

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Ngày tải lên : 07/03/2014, 21:20

... Hata, T., Hayashi, R & Doi, E (1967) Puriﬁcation of yeast proteinases Part III Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modiﬁcations Dgly CPY and Dgly proCPY, in which the asparagine ... the van’t Hoff enthalpy (DHv) was 1.05 (DHcal and DHv values were 585 and 557 kJÆmol)1, respectively) In contrast, a DSC analysis of the mature form (CPY) revealed an apparently symmetrical single...

7
439
0

Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx

Ngày tải lên : 09/08/2014, 10:23

... interpretation of data, manuscript preparation, and statistical analysis SKT participated in acquisition of data, analysis and interpretation of data, and manuscript preparation SC participated in acquisition ... preparation, and statistical analysis J-PP participated in study design, analysis and interpretation of data, and manuscript preparation JM-P participated in study design, analysis and interpretation ... data and manuscript preparation All authors read and approved the final manuscript 13 14 15 16 Acknowledgements The authors thank Virginia Wallis for her assistance in manuscript preparation and...

10
536
0

Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

Ngày tải lên : 13/08/2014, 18:21

... initial reliability and validity data J Am Acad Child Adolesc Psychiatry 1997, 36(7):980-988 18 Shaffer D, Gould MS, Brasic J, Ambrosini P, Fisher P, Bird H, Aluwahlia S: A children’s global assessment ... Rheumatoid Arthritis (1) Other (1) Malaria (1) *Numbers add up to more than 22, 50 and 24 because some children had multiple diagnoses Ryland et al Child and Adolescent Psychiatry and Mental Health ... manuscript AJL designed and coordinated the study, supervised the data analysis and the writing process MH has been responsible for creating data files, has supervised the data analyses and commented on...

8
368
0

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

Ngày tải lên : 10/08/2014, 05:20

... 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') and sequenced by using ABI-Prism 310 automatic sequencer ... DNA were amplified by PCR in standard conditions For CCR5-Delta 32 allele, a primer pair including the deletion was used (CCR5-D32-F: 5'CTTCATTACACCTGCAGCT3' and CCR5-D32-R: 5'TGAAGATAAGCCTCACAGCC3'); ... sequencer (Applera), according to the manufacturer's protocol For the CD45C77G allele, a fragment including the mutation was obtained by using primers CD45-F: 5'-GATTGACTACAGCAAAGATGCCC-3' and CD45-R:...

4
384
0

Shorter GT repeat polymorphism in the heme oxygenase-1 gene promoter has protective effect on ischemic stroke in dyslipidemia patients potx

Ngày tải lên : 10/08/2014, 05:21

... NF-kappa B and AP-2 in the promoter region of the human heme oxygenase gene Proc Natl Acad Sci USA 1994, 91:5987-5991 Yamada N, Yamaya M, Okinaga S, Nakayama K, Sekizawa K, Shibahara S, Sasaki ... 113:217-223 Kawamura K, Ishikawa K, Wada Y, Kimura S, Matsumoto H, Kohro T, Itabe H, Kodama T, Maruyama Y: Bilirubin from heme oxygenase-1 attenuates vascular endothelial activation and dysfunction Arterioscler ... changes during and after intensive long-lasting exercise Int J Sports Med 1981, 2:121-123 Kimpara T, Takeda A, Watanabe K, Itoyama Y, Ikawa S, Watanabe M, Arai H, Sasaki H, Higuchi S, Okita N,...

9
127
0

A potential protective effect of α-tocopherol on vascular complication in spinal cord reperfusion injury in rats pptx

Ngày tải lên : 10/08/2014, 05:21

... 37°C and 38°C by a thermal pad and a heating lamp The femoral artery was cannulated with a 22-gauge PE catheter, which was used to monitor distal arterial pressure (DAP) and for intra-arterial ... (Leo, Ballerup, Denmark); Prostaglandin E2 EIA kit and indomethacin (Cayman Chemical, Ann Arbor, MI, USA) and nitrate reductase from Aspergillus (Sigma) Statistical analysis Data were expressed as ... Tekelia A, Kurtkayab O, Civeleka A, Isbira S, Aka K, Arsanc S, Savb A: Neuroprotective effects of FK-506, L-carnitine and azathioprine on spinal cord ischemia-reperfusion injury European Journal...

9
240
0

Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx

Ngày tải lên : 12/08/2014, 11:22

... the last five years honoraria for attendance at advisory boards from AstraZeneca and Novartis totalling €10,000 His department has received the last five years grants from AstraZeneca, totalling ... Long-term ICS treatment has a protective effect on bronchial hyperresponsiveness, as measured with inhaled AMP [24], but an ICS has also a small immediate protective effect against AMP induced bronchoconstriction, ... was compared between treatments in an additive analysis of variance model with subject, period and treatment as fixed factors and the test-day baseline FEV1 as covariate Mean changes in FEV1 and...

9
308
0

Báo cáo y học: " Protective effects of hydrogen-rich saline on monocrotaline-induced pulmonary hypertension in a rat model" potx

Ngày tải lên : 12/08/2014, 13:22

... Ohsawa I, Shinmura K, Tamaki K, Kimura K, Endo J, Katayama T, Kawamura A, Kohsaka S, Makino S, Ohta S, Ogawa S, Fukuda K: Inhalation of hydrogen gas reduces infarct size in the rat model of myocardial ... Kamezaki F, Tasaki H, Yamashita K, Tsutsui M, Koide S, Nakata S, Tanimoto A, Okazaki M, Sasaguri Y, Adachi T, Otsuji Y: Gene transfer of extracellular superoxide dismutase ameliorates pulmonary ... Y: Changes in maximal performance of inspiratory and skeletal muscles during and after the 7.1-MPa Hydra 10 record human dive Eur J Appl Physiol 2000, 81:325-328 Shirahata S, Kabayama S, Nakano...

8
257
0

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Ngày tải lên : 25/10/2012, 11:10

... the investigators‟ DXA (Total Body Dual-energy X-ray Absorptiometry) database, from participants at a local health fair, and from referrals from subjects who agreed to participate All subjects ... Exova Labs, Chicago, IL for confirmation of nutrient levels and absence of heavy minerals and other contaminating ingredients Calcium, magnesium and other minerals were validated by Advanced Labs, ... data, some of the explanation may be attributed to what appears to be optimal levels of vitamin D3 (1,000 IU) and calcium (750 mg) that were in the Plan version of AC An additional benefit may...

12
663
0

Bob has a Surprise visittor

Ngày tải lên : 25/10/2013, 21:20

30
233
0

FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture

Ngày tải lên : 27/10/2013, 00:15

... installation and maintenance can be accomplished quickly and easily Additionally, easy access at the MST facilitates maintenance and troubleshooting by allowing technicians to simply unplug a connector ... instructions and materials for cleaning hardened connectors and adapters To clean the connector and adapter, the dust caps and plugs are removed to expose the inner optical components The adapter can then ... non-technical field installation of the drop cable Cleaning techniques for these hardened connectors have also been simplified, enabling improved reliability and maintenance Kits are available with easy...

4
447
1

Leadership sopranos style - how to become a more effective boss (dearborn 2004)

Ngày tải lên : 27/02/2014, 20:49

... financial crises—but he has a knack for handling these issues with uncanny skill Tony also has flaws like any leader, and we can learn a lot by identifying his weaknesses and analyzing his mistakes ... claim Tony Soprano is a perfect leader, and I acknowledge that he is a tragically flawed human being I would argue, however, that he is a remarkably effective, empathetic boss who can teach MBAs ... charisma draws people toward them and creates instant loyalty and respect Tony Soprano has charisma in spades But why? What does Tony that generates this charisma? More to the point, what can...

197
1K
0

Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inﬂammation in experimental rats ppt

Ngày tải lên : 08/03/2014, 08:20

... aminotransferase (AlAT), aspartate aminotransferase (AsAT) and LDH was assessed The present study also investigates the anti-inﬂammatory property of curcumin and capsaicin when fed in combination on carrageenan-induced ... be assessed by leakage of enzymes such as alanine aminotransferase (AlAT), aspartate aminotransferase (AsAT) and lactate dehydrogenase into blood [52,53] Higher activities of all these three enzymes ... described by Yagi [27], using 1,1,3,3-tetraethoxypropane as reference Serum enzymes Plasma-nonspeciﬁc enzymes, aspartate aminotransaminase (AsAT, EC.2.6.1.1) and alanine aminotransaminase (AlAT, EC.2.6.1.2),...

10
498
3

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

Ngày tải lên : 13/03/2014, 14:19

... financial management and operation process Applying a more detailed calculation, ABC provides economists a better database with higher level of accuracies and reliabilities compare to traditional ... to access various sources of information nowadays Manual works in manufacturing has a negative relation with the number of machines that are equipped in factories For example, in the past, a car ... of plants are trying to broaden their capacity each year Generally, small companies not have so many capitals as a result; they can not expand their capacity With such kind of this company, adopting...

64
512
0

Episode 3 Hector has a date pot

Ngày tải lên : 15/03/2014, 17:20

... million-aire? HECTOR Psst, psst! Am I a millionaire? NICK [Laughs] Are you a millionaire? Are you a millionaire? [Laughs] Ha! We are millionaires! BRIDGET and ANNIE Good – good BRIDGET Well you can ... to wear? HECTOR But Nick, what about Bridget and Annie? NICK Aha! It’s not a problem! HECTOR [Laughs] Ah-ha-ha! Yes! ANNIE [sending email] ‘Nadia, it’s terrible news Hector killed my plant with ... Episode Hector Has a Date 11 HECTOR So, Nick, what should I say? NICK It’s easy, relax HECTOR Yeah, but you have had a hundred girlfriends NICK Yeah, well, when I said a hundred, it’s actually fewer...

16
331
1

Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx

Ngày tải lên : 16/03/2014, 13:20

... acid capsule is a virulence factor for mucoid group A streptococci Proc Natl Acad Sci USA 88, 8317–8321 49 Kawabata S, Kuwata H, Nakagawa I, Morimatsu S, Sano K & Hamada S (1999) Capsular hyaluronic ... deionized water (pH 9.0) containing 5% methanol as separation buffer A voltage of 20 kV was typically applied during CE separation, and +5 kV was used as electrospray voltage Mass spectra were acquired ... the HS:19 serostrain and have shown that these labile groups are an a- l-sorbofuranose branch attached at C2 of b-d-GlcA and a MeOPN modiﬁcation located at C4 of b-d-GlcNAc There are very few reports...

15
430
0

$Báo cáo khoa học: Protective effect of active oxygen scavengers on protein degradation and photochemical function in photosystem I submembrane fractions during light stress pdf$

Báo cáo khoa học: Protective effect of active oxygen scavengers on protein degradation and photochemical function in photosystem I submembrane fractions during light stress pdf

Ngày tải lên : 16/03/2014, 18:20

... as primary elicitors, as products and propagators of oxidative damage, or as signal molecules initiating defense or adaptation [23–25] Several authors proposed that oxidative mechanisms are at ... gallate at mm for -OH and alkoxyl radicals, and SOD and catalase at 250 lgÆmL)1 for O2– and H2O2, respectively [28,29] • S Rajagopal et al temperature of 20 °C Each CD spectrum was the average ... PsaA was stable until h of illumination and then started degradation (Fig 4) The PSI core is mainly composed of bulk antenna Chl that absorbs in a broad band with a maximum at 680 nm, but also...

11
405
0

Which Aesthetic Has the Greatest Effect on Human Understanding? pdf

Ngày tải lên : 16/03/2014, 18:20

... compared over the aesthetic dimension Thus, while c- has a cross-less value of 0.87, In- has a value of 0.16; s + has a symmetry value of 0.96, o + has an orthogonality value of 0.46 This variation ... The statistical analysis used here is a standard ANOVA analysis [9], based on the critical values of the F distribution: a is the level of significance, and results that are not significant are ... themselves can be judged with respect to how much they assist human comprehension Many application domains may make use of automatic graph layout algorithms in order to display relational data in a holistic...

14
317
0

Báo cáo khoa học: Association of RNA with the uracil-DNA-degrading factor has major conformational effects and is potentially involved in protein folding pot

Ngày tải lên : 22/03/2014, 16:21

... follows: Cy3-labelled 30mer (Cy3, 5Â-AC GAATTCGTAAUATGCCTACACTGGAGCA-3Â), Cy3-labelled 60mer (Cy3, 5Â-CTCGCAAATGAACTGGGCGA TGCGGTCGCACUACTTCACCTCGAAATCAACATCT GAGTG-3Â), primers specic for domain V of ... allow accumulation of uracilcontaining DNA at least at specic developmental stages [6] By the use of afnity chromatography for searching additional uracil-DNA-recognizing factors in late larval ... spectra for RNA-UDE (as above), UDE (as above), and RNase-treated RNA-UDE (open black circles) Bottom left: spectra for RNA-UDE (as above), UDE (as above), and RNase-treated and repuried RNA-UDE...

21
465
0