hoppe director of marketing atg
SEO search engine optimization 2nd edition 2011
... Your Site to Directories 279 What Are Directories? .280 Submitting to directories 281 Major online directories 283 Paid vs free directories ... faint of heart It requires a lot of time and a lot of hard work What it doesn’t require is a professional Anyone with time and the desire to it can learn the most successful strategies of SEO ... 2-1 Number of Items Sold (or number of clicks) The Long Tail of search represents dozens of search terms that each generate a few clicks each month Broad Head Long Tail Inventory of Individual...
- 531
- 665
- 0
Báo cáo khoa học: "Using Search Engines for Robust Cross-Domain Named Entity Recognition" ppt
... occurrences of numbers and special characters in s−1 and s1 in titles of the search result The TITLE - WORD feature (line 16) computes the fraction of occurrences of w0 in the titles of the search ... line of work in that it empirically investigates features with good cross-domain generalization properties The main contribution of this paper is the design and evaluation of a novel family of ... the query consisting of, in most cases, 10 snippets,2 each of which contains 0, or more hits of the search term wi We then compute features for the vector representation of wi based on the snippets...
- 11
- 360
- 0
search engine optimization for dummies (2004)
... Peter was the founder of an e-Business Service Provider funded by one of the world’s largest VC firms, Softbank/Mobius He was VP of Web Solutions for a national ISP and VP of Marketing for a Web ... number of reasons: ߜ At the time of writing, almost 50 percent of site visits begin at the search engines Sure, it’s not 80 percent, but it’s still a lot of traffic ߜ Of the over 50 percent of visits ... front of probably over 95 percent of all searchers Well, perhaps you’re in front of them You have a chance of being in front of them, anyway, if your site ranks highly Determining Your Plan of Attack...
- 387
- 738
- 0
search engine optimization for dummies 2nd edition may 2006
... Peter was the founder of an e-Business Service Provider funded by one of the world’s largest VC firms, Softbank/Mobius He was VP of Web Solutions for a national ISP and VP of Marketing for a Web ... to be one of the wonders of the modern world: The search engines have tens of thousands of computers, evaluating 10 or 20 billion pages, and returning the information in a fraction of a second.) ... straight and narrow And, of course, the multitude of Wiley staff involved in editing, proofreading, and laying out the book Publisher’s Acknowledgments We’re proud of this book; please send...
- 428
- 376
- 0
search engine optimization for dummies, second edition; peter kent (wiley, 2006)
... Peter was the founder of an e-Business Service Provider funded by one of the world’s largest VC firms, Softbank/Mobius He was VP of Web Solutions for a national ISP and VP of Marketing for a Web ... to be one of the wonders of the modern world: The search engines have tens of thousands of computers, evaluating 10 or 20 billion pages, and returning the information in a fraction of a second.) ... straight and narrow And, of course, the multitude of Wiley staff involved in editing, proofreading, and laying out the book Publisher’s Acknowledgments We’re proud of this book; please send...
- 428
- 374
- 0
search engine optimization for dummies; peter kent (wiley, 2004)
... Peter was the founder of an e-Business Service Provider funded by one of the world’s largest VC firms, Softbank/Mobius He was VP of Web Solutions for a national ISP and VP of Marketing for a Web ... number of reasons: ߜ At the time of writing, almost 50 percent of site visits begin at the search engines Sure, it’s not 80 percent, but it’s still a lot of traffic ߜ Of the over 50 percent of visits ... front of probably over 95 percent of all searchers Well, perhaps you’re in front of them You have a chance of being in front of them, anyway, if your site ranks highly Determining Your Plan of Attack...
- 387
- 700
- 0
RADIO NETWORK OPTIMIZATION FOR BEGINNER
... quan Bước q trình quản lý chất lượng mạng phải định nghĩa số chất lượng dịch vụ (QoS : Quality of Service ) tỉ lệ rớt gọi, tỉ lệ gọi thành cơng, Các số hỗ trợ phát cell có chất lượng dịch vụ ... phải thiết kế cho số lượng tài ngun (nâng cấp TRX) đáp ứng lưu lượng u cầu khách hàng (traffic offered) Các dấu hiệu: Khách hàng phản ánh “mạng bận” (network busy) Các thị chất lượng dịch vụ...
- 69
- 708
- 2
Finite time exergoeconomic performance optimization for an irreversible universal steady flow variable-temperature heat reservoir heat pump cycle model
... plants He has been the Director of the Department of Nuclear Energy Science and Engineering and the Director of the Department of Power Engineering Now, he is the Superintendent of the Postgraduate ... performance optimization 5.1 Optimal distributions of heat conductance If heat conductances of hot- and cold-side heat exchangers are changeable, the profit rate of the irreversible universal heat pump ... values of x and y are always in their ranges The & dimensionless profit rate is defined as Π = Π (0.9mTL CVψ ) Figure shows the effect of the price ratio (ψ ψ ) on the dimensionless profit rate...
- 18
- 609
- 0
Exergoeconomic performance optimization for a steadyflow endoreversible refrigeration model including six typical cycles
... plants He has been the Director of the Department of Nuclear Energy Science and Engineering, the Superintendent of the Postgraduate School, and the President of the College of Naval Architecture ... and Power Now, he is the President of the College of Power Engineering, Naval University of Engineering, P R China Professor Chen is the author or coauthor of over 1220 peer-refereed articles ... analysis According to the properties of working fluid and the theory of heat exchangers, the rate of heat transfer QH and QH released to the heat sink and the rate of heat transfer QL (i e the cooling...
- 10
- 1,256
- 1
Topology Optimization for DHT-based Application Layer Multicast
... forward multicast data Thus, our method can make tradeoff between depth of the multicast tree and bandwidth of every node and take advandtages of DHTs in maintaining multicast tree in churn overlay ... caculating node’s identify Level of a node is used to define maximum number of its child nodes As a result, in our model, each node is assigned an optimal numbers of child nodes to forward multicast ... nút multicast ảo gán ID xác định sau: ID of level-0 nút (nút gốc ) IDs of level-1 nút [1+x0.2m/l0], where x0Є{0…l0-1} Có l0 IDs at level -1 … IDs of level-n nút [n+ x0.2m/l0+ x1.2m/l0l1+...
- 14
- 394
- 0
Xây dựng máy tìm kiếm ảnh dựa trên công nghệ search engines
... cỏc phn t khỏc u gi mt vai trũ nht nh Human-Powered Directories - Cỏc th mc ngi qun lý v cp nht Cỏc th mc Internet - vớ d nh D ỏn th mc m - Open Directory Project (Dmoz.org) hũan ton ph thuc vo ... liờn kt [NO]FOLLOW trang ny Robots lp ch mc v ly cỏc liờn ALL = INDEX, FOLLOW NONE= NOINDEX, NOFOLLOW kt t trang ny Robots khụng lp ch mc v khụng ly ch s t trang ny 2.6.5.3 Nhc im ca file robot.txt ... Trong trng hp mt t khoỏ bao gm nhiu hn mt ch (hay t) thỡ cú th gi hp tt c cỏc ch ú l b t khoỏ (set of keywords) C s d liu m mỏy truy tỡm s dng thng c b sung cp nht nh kỡ bng cỏch quột (scan), iu...
- 48
- 573
- 0
optimization for advanced app marketers
... level Some apps get no more organic users at a rank of 10 than 20 So why pay to achieve a ranking of 10 when a rank of 20 delivers the same number of organic users for a lower cost? Fiksu identifies ... the tracking software dashboard, or by creating spreadsheets from the dashboard and conducting data analysis to draw conclusions This can potentially involve tens of thousands of data points ... these decisions It’s up to marketing staff to their best to draw conclusions from massive amounts of data and implement optimization decisions according to the processes of each network This manual...
- 22
- 249
- 0
22 global optimization for parameter estimation of dynamic systems lin chinese 2005
... Background • Parameter estimation is a key step in development of mathematical models • Models of interest may be ODEs/DAEs • Minimization of a weighted squared error r φ = θ,z µ s.t (zµ,m − zµ,m )2 ... possible to compute Taylor models of complex functions Taylor Models - Range Bounding • Exact range bounding of the interval polynomials – NP hard • Direct evaluation of the interval polynomials – ... extension of a function f (x) over X F (X) ⊇ {f (x) | x ∈ X} • Natural interval extension – leads to overestimation (dependence problem) Taylor Models • Taylor Model Tf – an interval extension of a...
- 18
- 283
- 0
Global optimization for parameter estimation of dynamic systems lin chinese 2005
... Background • Parameter estimation is a key step in development of mathematical models • Models of interest may be ODEs/DAEs • Minimization of a weighted squared error r φ = θ,z µ s.t (zµ,m − zµ,m )2 ... possible to compute Taylor models of complex functions Taylor Models - Range Bounding • Exact range bounding of the interval polynomials – NP hard • Direct evaluation of the interval polynomials – ... extension of a function f (x) over X F (X) ⊇ {f (x) | x ∈ X} • Natural interval extension – leads to overestimation (dependence problem) Taylor Models • Taylor Model Tf – an interval extension of a...
- 18
- 343
- 0
Tài liệu Instant Website Optimization for Retina Displays How-to docx
... book, you will find a number of styles of text that distinguish between different kinds of information Here are some examples of these styles, and an explanation of their meaning Code words in ... uploaded to the root directory of your site The Retina ICO file is double the amount of pixels Browsers will automatically look for this filename within the root directory of your site Next we ... inside of the tag of our HTML structure we'll add a call to include jQuery Then inside of the tag of...
- 56
- 601
- 0
Tài liệu Báo cáo khoa học: "Instance-based Sentence Boundary Determination by Optimization for Natural Language Generation" ppt
... the quality of our sentence boundary decisions, we implemented a baseline system in which boundary determination of the aggregation module is based on a threshold of the maximum number of propositions ... asked the sentence planner to describe the house with a set of attributes including its asking price, style, number of bedrooms, number of bathrooms, square footage, garage, lot size, property tax, ... (S3) Semantic cohesion also influences the quality of output sentences For example, in the real-estate domain, the number of bedrooms and number of bathrooms are two closely related concepts Based...
- 8
- 499
- 0
Tài liệu O&M Ideas for Major Equipment Types pptx
... Industrial Assessment Manual from the Office of Productivity and Energy Assessment at the State University of New Jersey, Rutgers, for the U.S Department of Energy Office of Industrial Technology 9.32 ... 102002-1 506, Office of Industrial Technologies, U.S Department of Energy, Washington, D.C DOE 2009 2009 Buildings Energy Data Book Prepared by Oak Ridge National Laboratory for the Office of Energy ... facilities where large amounts of process steam are used These systems use varying amounts of water depending on the size of the system, the amount of steam used, and the amount of condensate returned...
- 161
- 1,094
- 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt
... in the case of LepB, SipS and Spi A comparison of the site of cleavage of SpsB with that of Spi from S pneumoniae shows that they are cleaved at the same point, whereas, in the case of SipS from ... stability of SpsB in the presence of inhibitor arylomycin A2, 18 lL of puried length SpsB (stock concentration of 31 lm) was incubated with lL of arylomycin A2 (stock concentration of mm) or ... IsaA3Myc TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC TAGAATTCTTAATTTTTAGTATTTTCAGG TACATATGCACCATCACCATCACCATATTGTTACACCATATA TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC TAGAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC...
- 13
- 464
- 0
Planning And Managing Security For Major Special Events: Guidelines for Law Enforcement potx
... by the Office of Community Oriented Policing Services, U.S Department of Justice The opinions contained herein are those of the author and not necessarily represent the official position of the ... were the nature of the event and the extent of the threat from protestors or possibility of celebratory disturbances Often, they discussed crowd management in terms of taking a “soft approach at ... why changes should be made Executive Summary U.S Department of Justice Office of Community Oriented Policing Services Office of the Director As I have traveled around the country meeting with...
- 128
- 450
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25