hla dr dq genotyping by capillary electrophoresis for risk assessment for celiac disease

Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies

Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies

Ngày tải lên : 11/09/2015, 10:14
... (as in gel electrophoresis) or can be a liquid, in most cases a buffer solution In capillary electrophoresis, the medium is contained in a small capillary 40 Therefore capillary electrophoresis ... diagram of capillary electrophoresis system High performance capillary electrophoresis (HPCE) does not require the use of gels because the capillary walls provide mechanical support for the carrier ... necrosis 10 Other variants of cylindrospermopsin are demethoxy-cylindrospermopsin and deoxy-cylindrospermopsin Figure 3: Cylindrospermopsin Cylindrospermopsin is hydrophilic, so it is often extracted...
  • 177
  • 292
  • 0
Báo cáo khoa học: Angiotensin-converting enzyme inhibition studies by natural leech inhibitors by capillary electrophoresis and competition assay doc

Báo cáo khoa học: Angiotensin-converting enzyme inhibition studies by natural leech inhibitors by capillary electrophoresis and competition assay doc

Ngày tải lên : 23/03/2014, 12:20
... highly sensitive test of angiotensin I processing by ACE and its inhibition in a onestep analysis by capillary zonal electrophoresis Thus, we report for the first time in invertebrate the existence ... at °C Supernatants were collected and dried by speed-vac Finally, 30 lL sterile water was added on the pellet and peptides were analyzed by capillary zonal electrophoresis Samples (2 nL) were injected ... the ACE hydrolysis activity in absence or presence of selective inhibitor using capillary zonal electrophoresis, several parameters have to be established Fig shows the capillary zonal electrophoresis...
  • 6
  • 312
  • 1
báo cáo khoa học: "Capillary electrophoresis for the characterization of quantum dots after non-selective or selective bioconjugation with antibodies for immunoassay" docx

báo cáo khoa học: "Capillary electrophoresis for the characterization of quantum dots after non-selective or selective bioconjugation with antibodies for immunoassay" docx

Ngày tải lên : 11/08/2014, 00:22
... used was 50 mM borate, pH 9.2 Gravity injection performed by elevating inlet capillary cm for s Applied voltage for CE separation was 20 kV Capillary temperature maintained at 20°C Excitation ... used was 50 mM borate, pH 9.2 Gravity injection performed by elevating inlet capillary cm for s Applied voltage for CE separation was 20 kV Capillary temperature maintained at 20°C Excitation ... used for conjugation was rabbit anti-human albumin CE buffer electrolyte used was 50 mM borate, pH 9.2 Gravity injection performed by elevating inlet capillary cm for s Applied voltage for CE...
  • 15
  • 301
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

Ngày tải lên : 14/09/2015, 10:36
... Cyclodextrin CE Capillary Electrophoresis CEC Capillary Electrochromatography CF Concentration factor CF-FAB Continuous-flow fast atom bombardment CGE Capillary gel electrophoresis CIEF Capillary isoelectric ... 1.3.3 Capillary Gel Electrophoresis (CGE)………………………… 15~16 1.3.4 Capillary Isoelectric Focusing (CIEF)……………………….… 16~17 1.3.5 Capillary Electrochromatography (CGE)……………………… 17~18 1.3.6 Capillary ... FMOC 9-fluorenylmethyl chloroformate GC Gas chromatography GC-MS Gas chromatography–mass spectrometry HPCE High performance capillary electrophoresis HPLC High performance liquid chromatography...
  • 16
  • 283
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

Ngày tải lên : 14/09/2015, 10:37
... Landers, Handbook of Capillary Electrophoresis, USA, 1996 [5] R Kuhn, S H Kuhn, Capillary Electrophoresis: Principles and Practice, Berlin, 1993 [6] P G Righetti, Capillary Electrophoresis in Analytical ... developed for the analysis of anions or cations Normal stacking mode (NSM) is the simplest among these It is performed by dissolving the sample in a low conductivity matrix and by injecting it hydrodynamically ... the driving force for the actual migration of species in the column in CE are their charges, the applied potential and EOF 3, Since the capillary applied in CE is normally empty (except Capillary...
  • 160
  • 1.2K
  • 0
Analysis of intact bacteria, bacterial DNA and mutagenic alkaloids by capillary electrophoresis

Analysis of intact bacteria, bacterial DNA and mutagenic alkaloids by capillary electrophoresis

Ngày tải lên : 15/09/2015, 17:11
... 1.1 Electrophoresis 1.2 History of capillary electrophoresis 1.3 Basic principles of capillary electrophoresis 1.4 Different modes of capillary electrophoresis 19 1.5 Instrumentation for capillary ... profile generated by an external pump, as used for HPLC EOF has a flat profile because its driving force (i.e., charge on the capillary wall) is uniformly distributed along the capillary, which ... utilized by Kuhr and Yeung [24] More importantly, since the first commercial instrument as the operation platform for electrophoresis was marketed in 1988, the development of capillary electrophoresis...
  • 173
  • 380
  • 0
On line pre concentration techniques in capillary electrophoresis for environmental analysis

On line pre concentration techniques in capillary electrophoresis for environmental analysis

Ngày tải lên : 16/09/2015, 15:55
... HPLC, the limits of detection (LOD) for capillary electrophoresis are constrained by the dimensions of the capillary For example, the small volume of the capillary limits the total volume of ... separation capillary was pre-conditioned prior to use with M NaOH solution for 20 min; followed by water for 20 min, and finally the BGE for mins The capillary was flushed using 0.1 M NaOH solution for ... compared the dual -capillary ITP-CZE system with one -capillary sample self-stacking system for the determination of hippurate in serum.the former provided better performance for real samples [159]...
  • 158
  • 536
  • 0
Tài liệu Seropositivity for celiac disease in children and adolescents with short stature doc

Tài liệu Seropositivity for celiac disease in children and adolescents with short stature doc

Ngày tải lên : 12/02/2014, 19:20
... Seropositivity for celiac disease in children and adolescents with short stature Queiroz MS, Nery M, Cançado EL, Gianella-Neto D, Liberman B Prevalence of celiac disease in Brazilian children of short ... EJ Should all children be screened for celiac disease? Gastroenterology 2005;128(4 Suppl 1):S98-103 23 Murray JA, Herlein J, Mitros F, Goeken JA Serologic testing for celiac disease in the United ... Diagnostic criteria for coeliac disease: time for change? Eur J Gastroenterol Hepatol 2005;17:41-3 32 21 Hill ID What are the sensitivity and specificity of serologic tests for celiac disease? Do sensitivity...
  • 5
  • 610
  • 0
Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

Báo cáo Y học: Characterization of heparin binding by a peptide from amyloid P component using capillary electrophoresis, surface plasmon resonance and isothermal titration calorimetry ppt

Ngày tải lên : 31/03/2014, 23:20
... approximately 85 lA at a capillary temperature thermostatting of 20 °C The capillary was rinsed after electrophoresis for with each of the following: 0.1 M NaOH, water, and electrophoresis buffer ... random coil or b sheet form are more favored A search for this sequence by using BLAST (Basic Local Alignment Search Tool) at NCBI (National Center for Biotechnology Information) shows that it ... N.H.H (2001) Capillary Electrophoresis In Protein– Ligand Interactions: Hydrodynamics and Calorimetry (Harding, S.E & Chowdhry, B.Z., eds), pp 171–195 Oxford University Press, Oxford, UK Connors,...
  • 8
  • 347
  • 0
Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx

Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx

Ngày tải lên : 09/08/2014, 01:24
... while DQ3 and DQ6 was recorded in 60 of 143 and 85 of 143 cases, respectively The corresponding numbers in the control group were for DQ2 , 73/200; for DQ3 , 100/200; and for DQ6 , 112/200 Other DR ... (7.0) 0.42 1.4 0.66–3.1 HLA DR3 -DQ2 -C4AQ0 / FcγRIIa R/R 20 (14) (3.5) 0.0005 4.5 1.8–10.9 HLA DR3 -DQ2 -C4AQ0 / FcγRIIIa F/F 29 (20) 19 (9.5) 0.007 2.4 1.3–4.5 HLA DR3 -DQ2 -C4AQ0 / MBL-low 11 (7.7) ... extracted by the salting-out method described by Miller and colleagues [18] Analysis of genetic polymorphism was predominantly performed by polymerase chain reaction (PCR) HLA HLA DR and DQ alleles...
  • 6
  • 292
  • 0
Báo cáo y học: "Association of IL-4RA single nucleotide polymorphisms, HLA-DR and HLA-DQ in children with Alternaria-sensitive moderate-severe asthm" pptx

Báo cáo y học: "Association of IL-4RA single nucleotide polymorphisms, HLA-DR and HLA-DQ in children with Alternaria-sensitive moderate-severe asthm" pptx

Ngày tải lên : 13/08/2014, 13:22
... previously reported HLA- DR2 (HLADRB1*15 and B1*16) /DR5 (HLA- DRB1*11 and HLADRB1*12) restriction, and in particular HLA- DRB1*1501 and HLA- DRB1*1503 genotypes as a risk factor for the development ... stimulation HLA- DR and HLA- DQ typing We subsequently examined frequencies of HLA- DR HLA- DP, and HLA- DQ in Alternaria-sensitive moderate-severe asthmatics (Table 3) The frequencies of HLADP were ... previously described [27,28] HLA typing In order to examine HLA- DR and HLA- DQ allelic frequencies in Alternaria-sensitive asthmatic, HLA- DR and DQ typing was performed in the HLA Laboratory as previously...
  • 9
  • 318
  • 0
Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants

Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants

Ngày tải lên : 14/09/2015, 11:40
... 3-(Cyclohexylamino)-2-hydroxy-1-propanesulfonic acid CCD contactless conductivity detection CD cyclodextrin CE capillary electrophoresis CEC capillary electrochromatography CGE capillary gel electrophoresis ... 101 Figure 3.15 Electrophoresis of 2-Log DNA Ladder by CE-UV 102 Figure 3.16 Electrophoresis of ΦX174 DNA by CE-LIF 103 Figure 3.17 Electrophoresis of 2-Log DNA Ladder by CE-LIF 103 Figure ... Surfactant as capillary wall via hydrophobic Buffer and/or ionic interactions, and Additive change the EOF drastically Neutral hydrophobic polymer Neutral may adsorb to the capillary Hydrophobic...
  • 223
  • 752
  • 0
Capillary and microchip electrophoresis for the analysis of small biomolecules

Capillary and microchip electrophoresis for the analysis of small biomolecules

Ngày tải lên : 02/10/2015, 12:56
... spectrometry CE: Capillary electrophoresis HPLC: High performance liquid CGE: Capillary gel electrophoresis chromatography CIEF: Capillary isoelectric focusing HPLC-MS: High performance liquid ... silica capillary was conditioned with M sodium hydroxide, M hydrochloric acid and water for 10 each Before experiment, the conditioned capillary was first flushed with water followed by the running ... achieved by the application of different modes of CE like microemulsion electrokinetic chromatography (MEEKC), capillary gel electrophoresis (CGE), non-aqueous capillary electrophoresis (NACE) and capillary...
  • 95
  • 525
  • 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Ngày tải lên : 03/11/2012, 09:57
... cells and dendritic cells also express HLA- DR on their surface [3] To assess the relative contribution of shed to total HLA- DR, the sHLA -DR in the plasma was compared to the total HLA- DR present ... Primer Select software (DNA Star) Forward HLA- DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA- DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA- DR measurement by ELISA Ninety six well ELISA ... assayed for sHLA -DR there was a significant dose dependent increase in sHLA -DR, p=0.04 Friedman test (Figure 6) Discussion A lowered expression of both the percentage of monocytes expressing HLA- DR...
  • 11
  • 618
  • 0
Tài liệu Development of an Observe-By-Wire System for Forklifts Using Haptic Interfaces pptx

Tài liệu Development of an Observe-By-Wire System for Forklifts Using Haptic Interfaces pptx

Ngày tải lên : 17/12/2013, 11:15
... improve the visibility as well as forklift performances OBSERVE BY WIRE FOR FORKLIFTS 2.1 System overview Operating a forklift is a specialized job Drivers control forks and its direction through ... changed by clicking and moving to the desired position The red area is referred to any package, which is assumed that this package is placed before the driver’s performance Therefore, driver must ... Where Fsp is assistance force; Falig , F fr and Fin are the aligning force, friction and inertia force, respectively The driving torque equals a constant value due to the forklift mechanism [11]...
  • 6
  • 455
  • 0
Tài liệu Development of an Observe-By-Wire System for Forklifts Using Haptic Interfaces docx

Tài liệu Development of an Observe-By-Wire System for Forklifts Using Haptic Interfaces docx

Ngày tải lên : 23/12/2013, 00:15
... improve the visibility as well as forklift performances OBSERVE BY WIRE FOR FORKLIFTS 2.1 System overview Operating a forklift is a specialized job Drivers control forks and its direction through ... changed by clicking and moving to the desired position The red area is referred to any package, which is assumed that this package is placed before the driver’s performance Therefore, driver must ... Where Fsp is assistance force; Falig , F fr and Fin are the aligning force, friction and inertia force, respectively The driving torque equals a constant value due to the forklift mechanism [11]...
  • 6
  • 507
  • 0
Tài liệu Development of an Observe-By-Wire System for Forklifts pptx

Tài liệu Development of an Observe-By-Wire System for Forklifts pptx

Ngày tải lên : 22/01/2014, 02:20
... improve the visibility as well as forklift performances OBSERVE BY WIRE FOR FORKLIFTS 2.1 System overview Operating a forklift is a specialized job Drivers control forks and its direction through ... changed by clicking and moving to the desired position The red area is referred to any package, which is assumed that this package is placed before the driver’s performance Therefore, driver must ... Where Fsp is assistance force; Falig , F fr and Fin are the aligning force, friction and inertia force, respectively The driving torque equals a constant value due to the forklift mechanism [11]...
  • 6
  • 472
  • 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Ngày tải lên : 27/01/2014, 15:20
... of any information presented after the date of publication This White Paper is for informational purposes only MICROSOFT MAKES NO WARRANTIES, EXPRESS, IMPLIED OR STATUTORY, AS TO THE INFORMATION ... introduced into a retrieval system, or transmitted in any form or by any means (electronic, mechanical, photocopying, recording, or otherwise), or for any purpose, without the express written permission ... technologies that you implement in the lab or of general test lab operations For links to conceptual information, general deployment information, and product details, see Related Links at the end of this...
  • 59
  • 1.1K
  • 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Ngày tải lên : 14/02/2014, 21:20
... sites of pain, which may be caused by the cancer, by treatment of cancer, by general debility or by concurrent disorders Accurate and meaningful assessment and reassessment of pain is essential ... account for a large number of patients who present with metastatic disease and cancer pain and who are hormone sensitive • Anti-androgen therapy for prostate cancer results in dramatic pain relief for ... infusions, with pamidronate and clodronate being the most commonly used, although these may in due course be replaced by newer, more potent, drugs such as zolendronate and ibandronate • There is...
  • 116
  • 548
  • 0

Xem thêm