het s prion carries out a normal function

Báo cáo khoa học: Energy barriers for HET-s prion forming domain amyloid formation potx

Ngày tải lên : 23/03/2014, 05:22

... exponential phase, and reached a maximum at the plateau phase [17] This observation, together with the reported changes in CD and scattering signals, suggests that b-sheet formation and aggregate ... presence of salt (data not shown), suggesting an increase in the population or compactness of the intramolecularly or intermolecularly collapsed species This stabilization of the basal state is ... JS, Sabate R, Saupe SJ & Steven AC (2007) Mass analysis by scanning transmission electron microscopy and electron diffraction validate predictions of stacked beta-solenoid model of HET- s prion...

12
210
0

the structure and meaning of president nguyen minh triet’s speech addressed on the occasion of the 1000th anniversary of the foundation of thang long – hanoi a systemic functional analysis

Ngày tải lên : 28/02/2015, 11:54

... views language as a communicative resource, not as grammatical rules It is considered “an effective tool of analysis, which solves the issues left out by traditional grammar” as it helps understand ... into a manageable set of process types Like English, Vietnamese transitivity systems are composed by six types: Material Process, Mental Process, Verbal Process, Behavioral Process, Relational ... 3.4 Clause and Clause Complexes Analysis The analysis of the text into clause and clause complexes and their logico-semantic relations can be presented as follows: Table 2: Clause and Clause Complexes...

69
445
1

an analysis of english inquiry letters in online shopping from a systemic functional grammar's perspective = phân tích thư yêu cầu tiếng anh trong mua bán trực tuyến theo quan điểm ngữ pháp chức năng hệ thống

Ngày tải lên : 02/03/2015, 14:25

... Systemic Functional Grammar to analyze English inquiry letters as a kind of discourse The importance of grammar in discourse analysis is obvious as Halliday stated " and it is sometimes assumed that ... this (discourse analysis) can be carried on without grammar- or even that it is somehow an alternative to grammar But it is an illusion A discourse analysis that is not based on grammar is not an ... interactional social- linguistics, conversation analysis, integrated approach Each approach plays an important role and they study discourse in different aspects In this thesis, we base on Systemic...

63
656
1

Before designing, check out the party! Here’s how to transform a dull layout into an energetic expression of the real event.

Ngày tải lên : 01/03/2016, 22:19

... Mine Summer Concert Series in the Sierra Nevada mountains is low-budget entertainment under the stars From a small stage beneath 150-foot pines, the rousing sounds of bluegrass, balladeers and ... bulbous foot SUMMER CONCERT Tiny negative spaces KENTUCKY Slit-like counters Fat body, stubby arm Poplar is a recent design based on an 183 0s original It s massive and powerful because it has almost ... the result is lifeless That s because it doesn’t express the subject Smooth surfaces and straight lines, for example, are elements of urban boardrooms (left), not the mountain outdoors (above)...

18
336
0

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Ngày tải lên : 25/10/2012, 11:40

... occasional, but hereditary factors can also be involved, especially in the most serious cases, otherwise it can be associated to genetic syndromes such as “Gardner Syndrome” or “Cleidocranial ... lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although anamnesis allowed to exclude stomatological pathologies, congenital anomalies ... routine hematological investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led...

7
597
0

A CRITICAL DISCOURSE ANALYSIS OF MARTIN LUTHER KING’S SPEECH ‘BEYOND VIETNAM – a TIME TO BREAK SILENCE’

Ngày tải lên : 07/09/2013, 12:58

... occurs is not Material Mental Material Material Material Relational Material Relational Actor Senser Carrier Senser Senser Actor Carrier Actor Actor Actor Sayer Sayer Sayer Sayer Carrier Sayer ... Identified Actor Actor Actor are adding must know are really involved must know realize has sent are create must cease must stop speak speak speak speak stands speak is ours must be ours is the message ... easily assume move seem are have found Mental Material Material Relational Material Relational Relational Material Mental Material Relational Relational Mental must speak must speak must speak...

38
1K
7

the meaning and structure of a narrative a systemic functional analysis

Ngày tải lên : 07/09/2013, 13:48

... further analyze the mistakes that learners easily make in specific situations Last but not least, a number of analytical instruments helps both teachers and learners deal with grammatical, semantic, ... Clause as Messages In each metafunction, an analysis of a clause gives a different kind of structure composed from a different set of elements In the ideational metafunction, a clause is analyzed ... to as Behaver, and this participant is always a conscious being For example: She cried Behaver softly Process Behavioural Circumstance Relational processes are the processes of being, being at,...

39
826
2

Who’s Afraid of ID, A Survey of the Intelligent Design Movement

Ngày tải lên : 01/11/2013, 08:20

... that p has no function Perhaps p had some other function and was simply co-opted After all, natural selection is a satisﬁcer and works with the materials actually available, not ones it hopes to ... proponents of ID are religious believers, and this is false: some, such as Michael Denton, are agnostics Besides this, as Ruse s introductory chapter points out, Aristotle accepted the design inference ... makes the designer responsible for natural evils such as parasitism This suggests that either the designer lacks some of the traditional attributes of God or does not exist at all Rather than be forced...

21
589
0

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Ngày tải lên : 15/12/2013, 03:15

... Expressions and Formulas a × a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + ... BALLS • LUBRICANTS AND LUBRICATION • COUPLINGS AND CLUTCHES • FRICTION BRAKES • KEYS AND KEYSEATS • FLEXIBLE BELTS AND SHEAVES • TRANSMISSION CHAINS • STANDARDS FOR ELECTRIC MOTORS • ADHESIVES AND ... Areas and Dimensions of Figures 69 Formulas for Regular Polygons 70 Circular Segments 73 Circles and Squares of Equal Area 74 Diagonals of Squares and Hexagons 75 Volumes of Solids 81 Circles...

3.3K
636
2

Tài liệu Mothers’ Investments in Child Health in the U.S. and U.K.: A Comparative Lens on the Immigrant ''Paradox'' docx

Ngày tải lên : 12/02/2014, 12:20

... mothers Does Access to Social Support Play an Explanatory Role? As a final step in the analysis we examine whether differences in social support access, both within and outside of households, account ... white, South Asian, black African and Caribbean, and other (largely East Asian) immigrants in the U.K Studying mothers’ own behaviors provides a proximate assessment of intergenerational and family-level ... the parameter estimates, changes in relationships across nonlinear models are best assessed through comparing changes in predicted values; in a nonlinear model changes in the coefficients also...

48
653
0

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Ngày tải lên : 12/02/2014, 20:20

... models of language such as TG, systemic functional linguistics possesses a very rich pool of analytical instruments which helps researchers tackle not only phonological but also grammatical (syntax), ... meaning and structure of a science fiction story: A sysyemic 29 Clauses and Clause Complexes Analysis The analysis of the text into clauses and clause complexes and their logico-semantic relations ... analysis shows that the text XVI which read as Its all right, she said consists of 36 clauses which make up 18 to the man We can breathe the air its a clause complexes Most of the clauses in...

18
712
4

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Ngày tải lên : 15/02/2014, 01:20

... and visualized by autoradiography acids, was expressed in Escherichia coli as proteins fused to glutathione S- transferase (GST) and puriﬁed using glutathione agarose 32P-labeled ETS-1 was ﬁrst ... CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 reverse d(CGC TCG AGT CAA TCA AGA ... EWS for binding to G-quadruplex DNA (A) EMSA was performed with EWS (lanes and 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and...

11
786
0

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Ngày tải lên : 16/02/2014, 14:20

... classiﬁed into several families that differ with respect to substrate speciﬁcity, processivity and the presence of associated domains, and include the SUV39, SET1, SET2, E(z), Riz, SMYD and SUV2-20 ... poor catalytic activity of the isolated MLL1 SET domain However, an analysis of crystal packing forces suggests that the SET-I lobe may be constrained in an unnatural conformation in the crystalline ... 1444–1454 Takahashi YH, Lee JS, Swanson SK, Saraf A, Florens L, Washburn MP, Trievel RC & Shilatifard A (2009) Regulation of H3K4 trimethylation via Cps40 (Spp1) of COMPASS is monoubiquitination independent:...

11
761
0

Is Lactobacillus GG Helpful in Children With Crohn’s Disease? Results of a Preliminary, Open-Label Study docx

Ngày tải lên : 05/03/2014, 12:20

... Quantitative variables are described as medians with ranges in parentheses The significance of changes was evaluated using analysis of variance (ANOVA) for parametric variables and the Mann–Whitney ... monocytes, 5% eosinophils); platelets 351,000/mm3; alanine aminotransferase level 1725 U/L; asparatate aminotransferase level 1185 U/L; alkaline phosphatase 353 U/L; gamma-glutamyl transpeptidase ... mucosal barrier Lactobacillus GG also has an impressive record of safety Indeed, although a liver abscess due to a Lactobacillus rhamnosus strain indistinguishable from LGG J Pediatr Gastroenterol...

5
511
0

Đề tài " Approximating a bandlimited function using very coarsely quantized data: A family of stable sigma-delta modulators of arbitrary order " pptx

Ngày tải lên : 05/03/2014, 23:20

... error estimates in sigma-delta modulation, J Amer Math Soc., to appear ¨ ¨ C S Gunturk, J C Lagarias, and V Vaishampayan, On the robustness of single loop sigma-delta modulation, IEEE Trans Inform ... 2); because of the explicit characterization of these sets, a proof that the 2Z2 -translates of Γx tile R2 is straightforward in this case The smoothness of the boundaries also makes it possible ... of signals, diﬀerent A/ D schemes are used; in this paper, we restrict our attention to a particular class of A/ D conversion schemes adapted to audio signals Note that at the end of the chain, after...

33
258
0

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Ngày tải lên : 06/03/2014, 01:20

... synthesized oligonucleotides for RevNES (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and ... 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection with a speciﬁc siRNA was ... puriﬁed using the RNeasy kit (Qiagen, Valencia, CA, USA) and cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR was performed...

12
454
0

Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx

Ngày tải lên : 07/03/2014, 10:20

... PD and LB dementias [Fig 2] a- synuclein can also be found as small oligomers or smaller aggregates associated with synapses and it is possible these forms contribute to the disease process rather ... demonstrates that simple increased expression of a- syncuclein could be sufﬁcient to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and ... conclusive evidence for a high afﬁnity Cu site but suggested that a loose association between many amino acids resides and Cu was possible As a variety of amino acids can bind Cu in solution, this...

9
467
0

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Ngày tải lên : 07/03/2014, 21:20

... of clade probability values Only values over 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio ... strongly suggest that DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, ... CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; DEBHANSE, Debaryomyces hansenii; DROME, Drosophila melanogaster; KLULAC, Kluyveromyces lactis; SACHER, Saccharomyces cerevisiae; SCHPO, Schizosaccharomyces...

7
658
0

Internal audit in banks and the supervisor’s relationship with auditors: A survey pdf

Ngày tải lên : 11/03/2014, 02:20

... methods, like scoring models and methods assessing qualitative and quantitative information The IIA s Standards state that internal audit activities should assist the organisation by identifying and ... assess the reliability of the accounting system and information and of resulting financial reports; • a compliance audit aims to assess the quality and appropriateness of the systems established ... ensure compliance with laws, regulations, policies and procedures; • an operational audit aims to assess the quality and appropriateness of other systems and procedures, to analyse the organisational...

16
522
0

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Ngày tải lên : 14/03/2014, 23:20

... least pounds since your nervous system and muscles will quickly adapt This 3-week phase serves two essential purposes First, it teaches you to focus on speed and total reps per exercise instead ... is a great question, another That 's where your warmup comes in and contrary to what I just said about being as handy Start with what looks like a ridiculously brief as possible, it requires a ... instead of a target number of sets and reps So instead of doing five sets of 5, you'll perform as many sets as it takes to get to 25 total reps and stop each set when the last rep is noticeably slower...

112
530
1