0

hepatitis a sources in food and risk for health

Rewiews in food and nutrition toxicity

Rewiews in food and nutrition toxicity

Cao đẳng - Đại học

... because ALD can be initiated in rats having normal intestinal flora Abnormal intestinal permeability (leaky gut), on the other hand, is a very plausible cause for endotoxemia In fact, a leaky ... and water Pasteurization readily kills the bacterium and can also be easily controlled by iodophores and chlorinating agents (Suihko and Haikara, 2001; Motoyama and Ogata, 2000; Satokari et al., ... that increasing alcohol consumption in humans was associated with higher total energy intake and higher intake of protein and fat This was associated with a decrease in carbohydrates, vegetables,...
  • 367
  • 435
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt

Báo cáo khoa học

... between +Al (–31%) and –CaMg (–43%) treatments An interaction between excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy ... vitality via a disturbance in stomatal regulation and leaf carbon assimilation In beech seedlings exposed to aluminium, Al accumulated in the parenchyma, and palisade cells always showed higher Al concentration ... seedlings may result in a loss in wood productivity Acknowledgements: The autors thank H.J Van Praag and F Weissen for supplying beech seedlings, and F Toussaint and A. M Defrenne for the maintenance...
  • 10
  • 376
  • 0
Tài liệu Pesticide Residues in Food and Cancer Risk: A Critical Analysis pdf

Tài liệu Pesticide Residues in Food and Cancer Risk: A Critical Analysis pdf

Y học thưởng thức

... 75, 13 6A1 5 8A U.S Food and Drug Administration (1992b) Exposure to Aatoxins. U.S Food and Drug Administration, Washington, DC U.S Food and Drug Administration (199 3a) Food and Drug Administration ... (1992) Risk assessment for aatoxin B1 : A modeling approach Risk Anal 12, 559567 Yamagami, T., Handa, H., Juji, T., Munemitsu, H., Aoki, M., and Kato, Y (1983) Rat pituitary adenoma and hyperplasia ... Cooking and Preparation of Food and Drink Cooking and preparation of food can also produce chemicals that are rodent carcinogens Alcoholic beverages cause cancer in humans in the liver, esophagus,...
  • 45
  • 591
  • 0
Báo cáo y học:

Báo cáo y học: "Assessment of balance and risk for falls in a sample of community-dwelling adults aged 65 and older" potx

Báo cáo khoa học

... Drusini AG, Eleazer GP, Caiazzo M, Veronese E, Carrara N, Ranzato C, Businaro F, Boland R, Wieland D: One-leg standing balance and functional status in an elderly community-dwelling population in ... Musculoskeletal conditions (in last month): Arthritis Low back pain General joint pain or stiffness Hip, leg and/ or knee pain Neck pain and/ or stiffness Muscle aches Foot and/ or ankle pain Headache Tingling ... counseling to tobacco users.) Data management and analysis Data were entered into an SPSS (Version 12.0 for Windows) database Quality control was performed by the principal investigator by reviewing...
  • 8
  • 372
  • 0
Vacuum assisted birth and risk for cerebral complications in term newborn infants a population based cohort study

Vacuum assisted birth and risk for cerebral complications in term newborn infants a population based cohort study

Y - Dược

... other maternal and infant risk factors – to neonatal brain injury Methods This study was based on information in two national databases held by the Swedish National Board of Health and Welfare, and ... intracranial hemorrhages as two separate outcomes: intra-cranial lacerations and haemorrhage due to birth injury and, intracranial non-traumatic haemorrhage of foetus and newborn After adjustment for ... non-traumatic intracranial hemorrhages, whereas infants delivered by CS had no increased risk for either traumatic or non-traumatic intracranial hemorrhages Maternal characteristics, parity, GA, and...
  • 10
  • 391
  • 0
Developing a sytem of abbreviation and symbols for note taking in interpreting

Developing a sytem of abbreviation and symbols for note taking in interpreting

Khoa học xã hội

... Acknowledgement Adjective Administration Advantage Adventure Adverb Advertisement After Agriculture Always Answer Apartment Approximately April Arrive Association Atmosphere August Automatic Avenue Beauty ... several ways among these ways And more than half of participants (64%) combined all ways above to abbreviate and symbolize In fact, there are many ways to create abbrs and symbols Some students take ... of note-taking in general and using abbrs and symbols for note-taking in particular is also stated Especially, students have to face with many problems in using abbrs and symbols such as: students...
  • 57
  • 612
  • 2
A review of non-financial incentives for health worker retention in east and southern Africa pot

A review of non-financial incentives for health worker retention in east and southern Africa pot

Tài chính doanh nghiệp

... countries (Botswana, Mauritius, Namibia, South Africa and Swaziland) and low-income countries (Angola, DRC, Kenya, Lesotho, Madagascar, Malawi, Mozambique, Tanzania, Uganda, Zambia and Zimbabwe) (HDR, ... Lesotho, Madagascar, Malawi, Mauritius, Mozambique, Namibia, South Africa, Swaziland, Tanzania, Uganda, Zambia and Zimbabwe While some effort was made to obtain a core set of information, it is ... situation in sub-Saharan Africa Table 2: Selected health indicators in ESA countries Efficiency Index* (and rank) Angola Botswana DRC Kenya Lesotho Madagascar Malawi Mauritius Mozambique Namibia...
  • 72
  • 430
  • 0
You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

Tâm lý - Nghệ thuật sống

... meant to be Branding is a great tool for both, because it makes you an active partner in your business and in your life destiny You Are a Brand! will teach you selfbranding strategies and career ... sales, and marketing skills, and by having a valuable network of business and personal contacts I am also going to talk about success in a larger sense, in terms of self-actualization— being who ... was a handicap “Why does an Asian art scholar want to be in advertising?” was the refrain But persistence does pay off One ad agency interpreted my background as “creative,” and I had a foot in...
  • 733
  • 532
  • 0
membrane technology a practical guide to membrane technology and applications in food and bioprocessing

membrane technology a practical guide to membrane technology and applications in food and bioprocessing

Hóa học - Dầu khí

... ultrafiltration” Bassam Jirjis is a Principal Chemical Engineer at Cargill Inc., in Minneapolis, Minnesota He has more than 25 years of experience in the area of separation technologies and food ... responsibility for ensuring that the company’s food and feed products and processes are safe, including being protected against intentional acts of adulteration and bioterrorism, and are compliant with ... including application of membranes in food and bioprocessing He is a coinventor of 27 US patents and 15 patents pending He has edited two books and has served as a key note speaker in many major...
  • 299
  • 2,188
  • 2
Báo cáo sinh học:

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Điện - Điện tử

... TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT ... TCGTCTAGAACAATACTGATC GGTCTCC CGGTCTAGAAGGTGATAGCC GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ... TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] DNA -A fla EACMV-KE-[TZT] DNA -A fl EACMV-TZ-[YV] DNA -A fl EACMV-TZ-[YV]...
  • 23
  • 612
  • 0
báo cáo hóa học:

báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

Hóa học - Dầu khí

... TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT ... TCGTCTAGAACAATACTGATC GGTCTCC CGGTCTAGAAGGTGATAGCC GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ... TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] DNA -A fla EACMV-KE-[TZT] DNA -A fl EACMV-TZ-[YV] DNA -A fl EACMV-TZ-[YV]...
  • 23
  • 522
  • 0
Báo cáo y học:

Báo cáo y học: "Protein, iron, and meat consumption and risk for rheumatoid arthritis: a prospective cohort study" pps

Báo cáo khoa học

... were calculated with median intake of each nutrient in each quintile as a continuous variable eAnimal and vegetable protein were adjusted for each other, total iron, and for the same variables adjusted ... and food intake, modeling this variable as a continuous variable Results Age standardized characteristics of the study population in 1990 according to intakes of total protein and heme iron are ... concept and design, data collection and analyses, and manuscript writing and editing DF contributed to the data analyses and statistical support, as well as to the manuscript writing and editing...
  • 8
  • 340
  • 0
Báo cáo y học:

Báo cáo y học: "Genetic polymorphisms in PTPN22, PADI-4, and CTLA-4 and risk for rheumatoid arthritis in two longitudinal cohort studies: evidence of gene-environment interactions with heavy cigarette smoking" potx

Báo cáo khoa học

... Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi ... statistical analysis S-CC was responsible for analysis and interpretation of data, manuscript preparation, and statistical analysis IDV was responsible for analysis and interpretation of data, manuscript ... and environmental factors interact in RA pathogenesis, and suggest that heavy cigarette smoking and PTPN22 may be acting in a similar mechanistic pathway Competing interests The authors declare...
  • 12
  • 336
  • 0
Báo cáo y học:

Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot

Báo cáo khoa học

... If these data are confirmed, a goldmine has been struck and OA therapy is in for dramatic changes Abbreviations ES = effect size; NSAID = nonsteroidal anti-inflammatory drug; OA = osteoarthritis; ... Abbott (Abbott Park, IL, USA), Amgen (Thousand Oaks, CA, USA), Astellas Pharma (Tokyo, Japan), Axellus (Oslo, Norway), Bristol-Myers Squibb Company (Princeton, NJ, USA), Cambridge Manufacturing ... Symptomatic efficacy and safety of diacerein in the treatment of osteoarthritis: a meta-analysis of randomized placebo-controlled trials Osteoarthritis Cartilage 2009, Oct 14 [Epub ahead of print]...
  • 3
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf

Báo cáo khoa học

... Covariates: initial BMI, and number of days between first and last recorded weight Separate analyses for each engagement variable Covariates as above and all engagement variables included in ... unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional physical activity by setting a target to expend a minimum of an extra ... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage...
  • 7
  • 284
  • 0
Toxicants residue in food and cancer risk: Captan (C9H8Cl3NO2S)

Toxicants residue in food and cancer risk: Captan (C9H8Cl3NO2S)

Tổng hợp

... Treatment - Gladioli and Tuberous Begonias Lawns and turf Ornamentals Azaleas, Carnations, Chrysanthemums, and Roses Oil farm Peach scab Exposure Pathways Food Air Water Routs Inhalation Ingestion ... hypertrophy and significant trends of adenomas and carcinomas in the kidney at 100 mg/kg/day - increased relative organ weight for heart, brain, liver, and thyroid/parathyroid Both sexes - showed an increased ... operations using captan captan in air (5 mg/m3) (high concentration) persistent erythema, itching, & desquamation of the face & backs of hands eye irritation including burning, itching and tearing Cancer...
  • 17
  • 221
  • 0
Uses of geothermal energy in food and agriculture  bopportunities for developing countries

Uses of geothermal energy in food and agriculture bopportunities for developing countries

Kỹ năng viết tiếng Anh

... Kenya in Africa, Costa Rica and El Salvador in Central America, and China, India and Indonesia in Asia (Table 4) Drying of agricultural products Drying of agricultural products is a very important ... Switzerland Romania Slovenia Croatia Serbia Liechtenstein Bosnia & Montenegro Andorra Herzegovina Bulgaria Monaco Albania FYR Moldova Italy Spain Austria Portugal Turkey Georgia Armenia Azerbaijan ... agricultural drying Zheng, Han and Zhang, 2010 Bathing and swimming, food processing Chandrasekharam and Chandrasekhar, 2010 Colombia Ecuador Peru 14.4 5 157 2.4 2.775 49.0 Asia China India 8 898...
  • 62
  • 528
  • 0
A cross cultural study of using hedges in refusing a request in english and vietnamese

A cross cultural study of using hedges in refusing a request in english and vietnamese

Khoa học xã hội

... reality being associated with a certain sound form There are two main types of meanings in words: lexical meaning and grammatical meaning Lexical meaning is the realization of concept or emotion For ... defined that an idiom is as a stable word with a solid formation and structure, and a complete and figurative meaning, used in everyday communication, especially in spoken language” According ... aims, data and sources are collected and gathered through reading and selecting numerous English and Vietnamese idiomatic expressions Then, the author categorizes and analyzes data of similes and...
  • 49
  • 740
  • 0
Overview of the Capital Markets in Vietnamand Directions for Development

Overview of the Capital Markets in Vietnamand Directions for Development

Ngân hàng - Tín dụng

... financial conglomerates.44 The transformation will call for formalized information sharing and coordination mechanism among financial regulators and law enforcement agencies 5.2 5.2.1 Market activities ... “state capital” that the SCIC will manage; and, Consolidate and industrialize small-scale operations in the private sector and partly adapt the capital market for facilitating the consolidation ... regulatory structure (iv) Statistical capacity building and setting an information sharing regime Establish a standard set of market indicators; Develop data sharing networks and safeguard protocols...
  • 71
  • 577
  • 0
Tài liệu Differences in 4-Year Health Outcomes for Elderly and Poor, Chronically III Patients Treated in HMO and Fee-for-Service Systems ppt

Tài liệu Differences in 4-Year Health Outcomes for Elderly and Poor, Chronically III Patients Treated in HMO and Fee-for-Service Systems ppt

Sức khỏe người cao tuổi

... 3.-Physical and Mental Health Outcomes for Patients Treated in Prepaid and Fee -for- Service Systems, Groups Differing in Age and Poverty Status Physical Health* Average Scores No Baseline* 4-y At Mental ... tertiles Age ?65 y and poverty Age -65 y and physical or mental health tertiles Poverty and physical or mental health tertiles Three-way interaction terms HMO and age -65 and physical or mental health ... on Aging, Bethesda, Md; the Agency for Health Care Policy and Research; and the National Institute of Mental Health, Rockville, Md Participating plans, professional organizations who assisted in...
  • 9
  • 621
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008