have a stable of world class companies with core knowledge based competencies which can compete effectively globally
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
Ngày tải lên :
05/09/2013, 09:08
... tank and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank through diffusers at a ... different samples at various SRT The BOD/COD of influent sample has an average of 0.66 This shows that the denimprocessing wastewater can be classified as rather easily biodegradable waste by aerobic ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost...
- 8
- 434
- 0
A MODEL OF NUTRITION INFORMATION SEARCH WITH AN
Ngày tải lên :
08/04/2014, 16:55
... can also be seen as a human capital variable, which refers to knowledge that can make an individual a more efficient producer of health From an individual’s point of view, both market goods and ... health is a capital good produced via time and money and thus determines the amount of time available for market and non-market activities and the amount of income available to purchase non-health ... parameter that can have useful interpretations is the depreciation rate of health δ This variable can have some useful interpretations by assuming that it is positively associated with age (Grossman,...
- 25
- 301
- 0
báo cáo hóa học:" Brazilian Network for HIV Drug Resistance Surveillance: a survey of individuals recently diagnosed with HIV" pot
Ngày tải lên :
20/06/2014, 08:20
... populated state capitals (Sao Paulo, Rio de Janeiro, Salvador, Porto Alegre, Brasilia and Belem), accounting for more than 70% of the Brazilian HIV/AIDS epidemic and the majority of patients under antiretroviral ... course of antiretroviral therapy in HIV/AIDS outpatients treated in Santos, Brazil Brazilian Journal of Infectious Diseases 2008, 12:162-166 De Medeiros LB, Lacerda HR, Cavalcanti AM, De Albuquerque ... Brites (Salvador, BA); Gisele Preusler, Ingrid Krilow, Maria da Gloria Correa, Sabrina Gilli, Lidia T Boullosa, Orlando C Ferreira Jr, Helena J Rosek (Porto Alegre, RS); Marcia CL Rachid, Mariza G...
- 6
- 416
- 0
Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf
Ngày tải lên :
21/06/2014, 19:20
... Salanova V, Worth R, Park HM, Wellman HN: Comparative study of interictal PET and ictal SPECT in complex partial seizures Acta Neurol Scand 1997, 95:129-36 Carrera E, Michel P, Despland PA, Maeder-Ingvar ... and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of penumbra [6] Its use has also been investigated for the diagnosis of seizures [13,14] Hauf et al demonstrated ... protocol at our institution Non-contrast CT did not reveal any early signs of stroke or hemorrhage The CT angiogram was unremarkable Perfusion CT demonstrated an area of shortened mean transit time...
- 4
- 447
- 0
Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc
Ngày tải lên :
21/06/2014, 20:20
... The mean value and variance can be calculated for 15–30 minutes before the peak; peak amplitude can be detected by the real peak value, and the width of peak can also be obtained at the same time ... is a nonlinear model with Gaussian state space A local linearization technique is applied to nonlinear equations and an approximate linear equation is obtained in (16) A series of values of hidden ... seizures of each patient According to the energy values calculated and parameter optimization, A = 2800 and B = 40 can be obtained Table shows the optimal parameters α and β for six patients based...
- 10
- 348
- 0
TPM - A Route to World-Class Performance ppt
Ngày tải lên :
27/06/2014, 06:20
... criticality assessment, condition appraisal, refurbishment plan and the asset care programme Core Team: These are the mixed shift based teams comprising operators and maintainers and a Team leader ... sustain competitive advantage We are particularly indebted to: Derek Cochrane and Derek Taylor of 3M Chris Rose and Clive Marsden of Adams Les Thomson and Mike Milne of BP Amoco Ian Barraclough of ... called Maintainer Asset Care) Availability: The actual run time of a machine as a percentage of its planned run time Best of the Best: An OEE figure calculated by multiplying the best weekly availability,...
- 270
- 290
- 0
AROUTETOiES3 PERFORMANCEI TPM - A Route to World-Class performance pptx
Ngày tải lên :
27/06/2014, 18:20
... criticality assessment, condition appraisal, refurbishment plan and the asset care programme Core Team: These are the mixed shift based teams comprising operators and maintainers and a Team leader ... sustain competitive advantage We are particularly indebted to: Derek Cochrane and Derek Taylor of 3M Chris Rose and Clive Marsden of Adams Les Thomson and Mike Milne of BP Amoco Ian Barraclough of ... called Maintainer Asset Care) Availability: The actual run time of a machine as a percentage of its planned run time Best of the Best: An OEE figure calculated by multiplying the best weekly availability,...
- 270
- 370
- 1
My hobbiesI have a number of things pptx
Ngày tải lên :
22/07/2014, 03:21
... can play a few simple tunes I have even begun to sing while playing the guitar but I has not been too successful at this My uncle tells me that all I need is a lot of practice and I should ... the stamps from discard envelope that my relatives and friends give me Mostly I get local stamps Once in while I get stamps from places like Sweden,Australia,Saudi Arabia and others I keep the ... the aquarium I have to this whenever it gets dirty which is about once in two months I keep stamps too However I would not call myself an avid stamp collector Actually, I just take the stamps...
- 5
- 501
- 1
Báo cáo toán học: "A Reformulation of Matrix Graph Grammars with Boolean Complexes" ppt
Ngày tải lên :
07/08/2014, 21:21
... matrices, we say that a ≺ b if ab = a, i.e whenever a has a 1, b also has a (graph a is contained in graph b) The four equalities in eq (4) can be rephrased as a1 ≺ a2 , a1 ≺ b2 , b1 ≺ a2 and b1 ≺ b2 ... digraph which permits all operations of s and does not contain any proper subgraph with the same property A negative initial digraph is a simple digraph that contains all the elements that can ... simplifies some manipulations The reader may however stick to the representation of Boolean complexes as pairs of matrices (a, b) All formulas and final results in this paper have an easy translation from...
- 36
- 243
- 0
Báo cáo lâm nghiệp: " Variation of the photosynthetic capacity across a chronosequence of maritime pine correlates with needle phosphorus concentration" pptx
Ngày tải lên :
08/08/2014, 00:22
... by a Binos 100 IRGA differential analyser calibrated with gas standards and cross-checked against a Licor 6262 Environmental parameters that were continuously measured in the chamber included air ... mineral concentrations Specific leaf area decreased significantly with increasing age from 6.2 to 5.2 m2 kg–1 (Tab IV) In addition, leaf nitrogen concentration on an area basis (Na) significantly ... explained by the higher values of photosynthetic capacity and intermediate level of stomatal conductance measured in the trees of this stand Leaf nitrogen concentration on an area basis appeared...
- 7
- 321
- 0
Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx
Ngày tải lên :
08/08/2014, 14:20
... spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarchy could be a level of structuring ... the variability of Sessile oak growth, morphology and wood quality, based on appropriate sampling plans and use of available statistical methods (mixed models) This programme associated the Office ... climates: north of Alsace (sandstone hills and sandy-loamy soils in the plain), Plateau lorrain, Val de Loire, Basse-Normandie, Allier-Bourbonnais (Center of France) In each region, a large range...
- 9
- 304
- 0
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
Ngày tải lên :
10/08/2014, 21:23
... seventy-eight patients assessed over an 11-year period They reported approximately 1/3 of varus deformities linked with cerebral palsy are associated with TP alone and a further 1/3 are associated with abnormal ... studies are available for each category, representation was based on the most recent work with the largest sample size Page of (page number not for citation purposes) Journal of Foot and Ankle Research ... medial malleolus (M) and tendo Achilles (TA) Small arrow indicates rounded TP tendon proximally and large arrow indicates the flattened area of tendon in retromalleolar region as a result of the...
- 8
- 530
- 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt
Ngày tải lên :
12/08/2014, 13:22
... variables measured at day 1, day 6, and the change in value between day and Stata 9.0 (StataCorp, College Station, Texas) computer software was used for statistical analysis All interval data ... variables on day of mechanical ventilation in a large observational trial and then validated it in two independently collected data sets Gajic et al found that PaO2/FiO2 ratio, Pplat, mean Paw, ... calculated for each variable (Table 3) The only variable associated with death in these analyses was a decrease in the Crs (OR 2.14, p = 0.02) between days and of mechanical ventilation for ALI...
- 8
- 351
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... preparation, microarray hybridization and scanning RNA quality was checked by Agilent Bioanalyzer and RNA Integrity Scores are higher than for all the samples cRNA amplification and labeling with biotin ... involved in cell apoptosis including chemical pathway, apoptosis, apoptosis_genmapp, caspase pathway, and SA_caspase_cascade (Table 6) In CD8+ T cells, the chemical pathway was significantly enriched...
- 21
- 376
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya 4
Ngày tải lên :
22/09/2015, 15:17
... private practice of family photography is also a wider social practice As paa Sao suggested, in addition to photographs of birthdays and graduations, the people of Ayutthaya have photographs of the ... memory We have more of them People have photographs of graduations and birthdays, people in Ayutthaya also have photographs of the flood [laughs] Paa Sao/ 52/ Souvenir vendor/ Female/ April 2014 ... Photographs of the flood as decorative images at a guesthouse, and exhibition materials at Ayutthaya hospital and outside Wat Mongkhon Bophit Paa Sao lives in a wooden stilt house at Long Law with...
- 37
- 191
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya 3
Ngày tải lên :
22/09/2015, 15:17
... Wat Mongkhon Bophit, Wat Suwandaram and Wat Senasaranam – the Ayutthaya Hospital, Ayutthaya historical park (areas in green) and Ayutthaya Riverside hotel 39 Later, we were repeatedly told that ... the visuality of mud lines, images and paint markings, I had overlooked the multi-sensual nature of memories As we boated along a small canal, we picked up an unpleasant stench of sewage and rotting ... more-than-human agency of photographic images was also an important part of the conversation Figure 3.7: Various participants brought along pictures and many asked us to compare the present landscape with...
- 21
- 172
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya 2
Ngày tải lên :
22/09/2015, 15:17
... engages memory as commemoration at scale of the nation, and many geographers have also adopted the nation as their analytical ‘collectives’ (see Azaryahu & Golan, 2004; Legg, 2005) Understandably, ... much alive and part of the active becoming of the world This can effectively alter the concept of ‘collective’ memory Instead of being a set of, often national, narratives which is articulated and ... unfolds within a spatial framework’, geographers have convincingly argued that all memories have a geography as they are often constructed and located through particular sites and social environments...
- 17
- 213
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya
Ngày tải lên :
22/09/2015, 15:17
... baan – villages 10 B A Fig 1.4 (A) : A map of Thailand Ayutthaya is located in central Thailand Ayutthaya province (highlighted in orange) is north of Bangkok (highlighted in pink), and the capital ... historical parks and green spaces The yellow areas are mostly residential and commercial areas with mixed land uses Note that the remnants of the old irrigation canals and moats pepper the landscape ... are still closely related to the rivers These relationships are often mundane and taken for granted For example, the names of several villages in Ayutthaya are associated with boats – Baan Samphao...
- 13
- 230
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya 7
Ngày tải lên :
22/09/2015, 15:19
... May 2014 Remained in contact with some participants via Facebook - Accompanied walks with 18 participants (Soi Si, Hua Ro, Long Law, Wat Senasanaram, Wat Suwandaram) Interview with a ‘cultural ... at Ayutthaya Riverside Hotel Attempted to contact the DDPM office again, was again unsuccessful - - - - Long Law Soi Si Hua Ro Wat Senasanaram Wat Suwandaram Historical Parks Office Ayutthaya ... lecturer at Rajabhat Phra Nakhon Si Ayutthaya University 61 49 61 27 53 52 39 52 Female Female Male Female Female Male Female Female 38 Male 59 Female 52 Female Appendix 3a Wat Mahathat towards the...
- 8
- 211
- 0
A community of flood memories living with(in) the riverine landscape in ayutthaya 6
Ngày tải lên :
22/09/2015, 15:19
... How are past floods articulated and enacted as memories by different groups of people within the lived landscapes of Ayutthaya Mainly through mundane and everyday acts of storytelling, image ... embodiment and enactment of the past ‘enable the ongoing conduct of everyday life’ (B Anderson, 2004: 8; emphasis original) in Ayutthaya These seemingly individual and personal enactments of memories are, ... thoughts’ – and is constantly being translated into worldly practices Emplaced at the strategic in-between of action and thought, memories of the 2011 flood are also important as they take on a productive...
- 6
- 177
- 0