gt repeat genotypes and arsenic exposure
GT-repeat polymorphism in the heme oxygenase1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure ppt
... HO-1 GT repeat polymorphism and the carotid atherosclerosis index The number of GT repeats in the HO-1 gene promoter of the participants ranged 16-38 (Figure 1) In both cohorts, 23 and 30 GT repeats ... age- and gender-adjusted analysis remained significant after additional adjustment for a hypertension history and diabetes history Interaction between HO-1 (GT) repeat genotypes and arsenic exposure ... regarding arsenic exposure The median level of arsenic concentration was unknown for some villages in the BFD-endemic area, in which case, the cumulative arsenic exposure or average arsenic exposure...
- 11
- 291
- 0
Interest Rate Swaps and Economic Exposure potx
... (See Myers and Majluf (1984) and Flannery (1986)) For formal proofs in the case of separating equilibria see Brennan and Kraus (1986) and for the case of pooling equilibria see Nachman and Noe (1994) ... from the high exposure firm by issuing a longterm debt 16 If the high exposure firm is not mimicked by the low exposure firm its short-term debt is correctly priced but the high exposure firm ... cash flow of a high exposure firm is lower than that of a low exposure firm If the low exposure firm issues a long-term debt to finance the project the high exposure firm mimics and also borrows...
- 30
- 383
- 0
Effects of compost and phosphate amendments on arsenic mobility in soils and arsenic uptake by the hyper
... of Fe–As and Ca–As, but increased water-soluble and exchangeable As (WE–As) and Al–As in the CCA soil For the ASC soil, however, treatments decreased Fig Soil pH (a and b) and DOC (c and d) in ... Chinese brake fern growing in arsenic contaminated soils; (2) to determine the effects of composts and phosphate rock on arsenic leachability in arsenic contaminated soils; and (3) to identify possible ... produce volatile arsenicals by a reductive pathway from inorganic and methylated forms of As (Onken and Adriano, 1997) Akins and Lewis (1976) added DSMA-74As to a soil system and measured a loss...
- 11
- 707
- 0
Maternal and fetal exposure to pesticides associated to genetically modified foods in Eastern Townships of Quebec, Canada docx
... expressed as number, range and mean ± SD for each group Characteristics of cases and controls and PAGMP exposure were compared using the Mann–Whitney U-test for continuous data and by Fisher’s exact ... Glyphosate (GLYP: A), Gluphosinate (GLUF: B) and 3-methylphosphinicopropionic acid (3-MPPA: C and D) in pregnant and nonpregnant women (A–C) and in maternal and fetal cord blood (D) Blood sampling ... PAGMF and whether these toxicants cross the placenta to reach the fetus Materials and methods 2.1 Chemicals and reagents For the analytical support (Section 2.3), GLYP, AMPA, GLUF, APPA and N-methyl-N-(tert-butyldimethylsilyl)...
- 6
- 307
- 0
báo cáo hóa học: " Chronic obstructive pulmonary disease (COPD) and occupational exposures" pptx
... understand the patient's occupational exposure and whether he/she has been adequately trained in the dangers of these exposures and how to manage them Removal of the respiratory irritants and substitution ... each job, and an assessment of the extent and duration of exposure The length of time exposed to the Page of (page number not for citation purposes) Journal of Occupational Medicine and Toxicology ... for COPD caused by these exposures was 20% In this study, the PAR for combined current and former smokers was 56% Smoking and occupational exposures to dusts, gases, and/ or fumes had greater...
- 6
- 366
- 0
Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx
... plasma and five CIMM-HCV isolates: serum from patient 081 was compared with 081-T1 and 112B-T1, serum from patient 238 was compared with 238-T1, and plasma from 313 was compared with 313-i and 313-T1 ... at three positions (107, 234, and 243) 112A-T1 and 112AB-T1 differed at two positions (106 and 243), while 081-T1 differed from 112AB-T1 at the same two positions and also at position 107 In addition, ... consensus sequences showed that 081 serum and PCLB-T1 and PCLB-T4a had one difference at position 204 (A vs C), while 081 serum and PCLB-T7 had no changes (Figure 4B) Repeated transfers to new cells of...
- 15
- 340
- 0
PESTICIDES IN THE MODERN WORLD – PESTS CONTROL AND PESTICIDES EXPOSURE AND TOXICITY docx
... (4.6% and 5.3%) and Gemmatimonadetes (1.4% and 1.9%) were Pesticides in the Modern World Pests Control and Pesticides Exposure and Toxicity Assessment present Whereas Acidobacteria (7.9%) and ... Modern World Pests Control and Pesticides Exposure and Toxicity Assessment 10 A B Fig UPGMA dendrograms of bacterial (A) and fungal (B) communities in rhizosphere and endorhiza of the medical ... agar and SNA for synthetic nutrientpoor agar d) number of replicate from to and e) number of isolate from to 14 14 Pesticides in the Modern World Pests Control and Pesticides Exposure and Toxicity...
- 626
- 982
- 0
Báo cáo khoa học: "The behavior of oaks in response to natural and induced exposure to the surfactant ABS" potx
... assess the effect of natural and artificial exposure to ABS on the leaf waxes of oak species and on the pollen quality of Quercus ilex in cultures of modified Brewbaker and Kwack (1963) solution ... analysis, is common along the Tuscan coast and in hilly areas further inland and for several years has exhibited abnormally intense flowering (Gellini and Paoletti, 1990) Pollen for our study was ... impaired function of the guard cells), lesions and cracks in the cuticle, trichome abscission and destruction, and the collapse of the secreting heads of glandular hairs (fig 1A-D) Damage decreased...
- 5
- 302
- 0
Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx
... between M1, M5 and heart myosin and M6, M24 and brain proteins Molecular mimicry between streptoccocal proteins and heart components has been proposed as the triggering factor of RHD, and CD4+ T ... appear to be DRB1*01 and DRB1*04, which is similar to results from Kudat and colleagues [8] and Wani and colleagues [14] All RF patients in this study have the risk allele DQA1*0401 and the protective ... at 10 V/cm in 0.5 mM TBE buffer and then examined under UV illumination and recorded [24-30] Statistics The HLA DRB1, DQA1 and DQB1 allele frequencies in patients and control subjects were compared...
- 9
- 327
- 0
Báo cáo y học: "Smoking and nicotine exposure delay development of collagen-induced arthritis in mice" pptx
... Sollentuna, Sweden) were used All animals were kept under standard environmental conditions and had free access to standard laboratory food and drinking water Ethical permission was obtained from ... anticollagen II antibodies and anti-cyclic citrullinated peptides (aCCP) Paws were taken for histologic evaluation and assessed for synovitis and erosion in joints Cigarette smoke exposure DBA/1 mice ... follows: = mild; = moderate; and = severe [25] Destruction of cartilage and subchondral bone was registered separately Knee joints, ankles, elbows, and wrists were inspected, and a mean score from all...
- 8
- 339
- 0
Báo cáo khoa hoc:"The 5S rDNA of the bivalve Cerastoderma edule: nucleotide sequence of the repeat unit and chromosomal location relative to 18S-28S rDNA" doc
... were 5’-CAACGTGATATGGTCGTAGAC-3’ (A) and 5’-AACACCGGTTCTCGTCCGATC-3’ (B), obtained from the 5S rRNA sequence of the mussel M edulis [6], and 5’-CAAGCACAGAGGCAGGAG-3’ (C) and 5’-CGATCCGCGGTTTACCTG-3’ ... rDNA repeat unit A single band of 550 bp was also obtained, and after cloning two clones were sequenced (Ce3 and Ce4) The complete repeat unit consists of 544-546 bp and the alignment of fulllength ... On the other hand, C edule differs from S velum and from M edulis at only four nucleotide positions, although C edule and S velum share a common ancestor in Precambrian and C edule and M edulis...
- 10
- 182
- 0
Shorter GT repeat polymorphism in the heme oxygenase-1 gene promoter has protective effect on ischemic stroke in dyslipidemia patients potx
... defined by the averaged length of (GT) n repeats Averaged length of (GT) n repeats of the HO-1 gene promoter was calculated for each patient Age was expressed as mean ± SD and compared by Student's ... distribution had two peaks at (GT) 23 and (GT) 30, respectively The averaged length of the (GT) n repeats had similar distribution, but they ranged from15 to 35 with peaks at 27 and 30 Therefore, we defined ... Therefore, we defined genotype short (S) for those with averaged length Ϲ26 GT repeats, and genotype long (L) for those with length of >26 GT repeats, which included around 70 percent of patients Stroke...
- 9
- 127
- 0
báo cáo khoa học: "RBCS1 expression in coffee: Coffea orthologs, Coffea arabica homeologs, and expression variability between genotypes and under drought stress" doc
... gagacaggcatttaatatttatactgaagctaatacgttcgtttggttaatgttaatagcagtagagtagagtaga -tagattaatatgctgatgcggggtttgtgatttggtgggtttgaacgtgtagAAAGGAT gagacaggcatttaatatttatactgaagctaatacgttcgtttggttaatgttaatagcagtagagtagagtagagtagatagattaatatgctgatgcggggtttgtgatttggtgggtt-gaacgtgtagAAAGGAC ... tcaaatttgaggctgcgattcttggcagttgacagttagttgtcaataaa AGGTGCAGTGCATCAGTTTCATTGCCGCCAAGCCAAAGGGTTTCTAAgccccttcttcacaaatttggccccggcccc tcaaatttgaggctgcgattcttggcagttgacagttagttgtcaataaa AGGTGCAGTGTATCAGTTTCATTGCCGCCAAGCCAAAGGGTTTTTAAgccccttcttcacaaattcggccccggccccgtcctcttcccctcaaatttgaggctacgtttcttggcagttgacagctagttgtcaataaa ... attgagaactggggctgtactttcaggtgtttttcttttttatttgcctttcccgtggtgggtctggttttgcttctattcttctcctttcttttttttccgctttgacattcggtttcggtgtatgtttccggatttcc RBCS1-Cc attgagaactggggctgtactttcaggtgtttttcttttttatttgcctttcccgtggtgggtctggttttgcttctattcttctcctttcttttttttccgctttgacattcggtttcgctgtatgtttccggatttcc...
- 24
- 627
- 0
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx
... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coordination and in discussing manuscript NH, NBF and ... bp), B (281 bp), and C (122 bp) for the first one and genotypes D (119 bp), E (167 bp), and F (97 bp) for the second These two genotyping methods are unable to identify genotype G and H Both HBV ... Three HBV genotypes were detected by PCR-RFLP: D, A and B (Figure 1) Genotype D was observed in 89% of the cases with a restriction pattern corresponding to D2 (undigested with Ava II and bands 306...
- 6
- 412
- 0
Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps
... in Germany and Greece, where the prevalence of HCV genotypes 1b and have decreased and genotypes 1a, 3a, and increased Such changes were not noticeable in Luxembourg where genotypes and were the ... prevalent genotype [16] and in Egypt genotype 4a was predominant [17], genotypes 1a and 1b were common in the United State and Europe [18,19] In Pakistan and Japan Genotypes 3a and 1b were common ... found to be positive for HCV and could thus be genotyped Four different genotypes were reported in this study including genotypes, 1,2,3 and The distribution of these genotypes were variable among...
- 7
- 257
- 0
Báo cáo y học: " Hepatitis B virus genotypes and precore and core mutants in UAE patients" ppt
... sequence[6] Genotype A is pandemic and is most prevalent in Northern Europe, North America, and Central Africa Isolates of genotypes B and C have been observed in Southeast Asia and the Far East Genotype ... USA and France[9] Genotype H was also recently found in Central America[10] The genotypes and subtypes are useful clinical and epidemiological markers[11,12] because it is well known that genotypes ... the anti-HBs monoclonal antibody, and vaccine resistance The following primers were selected: 1) FHBS1, 5'GAG TCT AGA CTC GTG GTG GAC TTC-3'; 2) FHBS2, 5'-CGT GGT GGA CTT CTC TCA ATT TTC-3'; 3)...
- 8
- 364
- 0
Báo cáo khoa học: " Hepatitis B virus genotypes and evolutionary profiles from blood donors from the northwest region of China" docx
... China blood donor candidates were mostly clustered into B and C genotypes These pathogens, which appear to have developed from a common parent, could not be clustered into similar genotypes from ... samples The serological and personal data of the HBV DNA-reactive donors are noted in Tables and Consistent with virus load, donors 3, 4, and had higher ALT levels (Table and Fig 1C), which were ... genome difference greater than 8% [24,25] Genotypes A, B, C and D are all observed in China Consistent with other reports, we confirmed that the B and C genotypes are the most common in China [26]...
- 7
- 351
- 0
Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx
... genotype and its subtypes 4a and 4c/d Mixed infection with the two genotypes was also detected HCV genotype and its subtypes are the predominant genotypes in Gaza strip (64.1%) Genotypes and were ... with genotype and genotypes or [25] Moreover patients infected with type and had a higher viral load than patients infected with other genotypes [26] The two major HCV genotypes (1 and 4) were ... The forward primer: CCCTGTGAGGAACTWCTGTCTTCACGC (W is A or T) and the reverse primer: GGTGCACGGTCTACGAGACCT were designed to specifically bind the region between -299 and -1 of HCV genome 5'UTR...
- 7
- 439
- 0
báo cáo khoa học: " Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis" pps
... Columbia Columbia Columbia Columbia Columbia Columbia Columbia Columbia Landsberg Landsberg Landsberg Landsberg Landsberg Landsberg Landsberg Columbia Columbia Columbia Leaf Flower – shoot Root Seed ... specificity and possible inducibility of expression for ~170 NBS-LRR-encoding and related genes Most of the NBS-LRR-encoding and related genes investigated were expressed at low levels and with ... effectors such as Apaf-1 and Ced-4 [33] The NBS domains of two NBS-LRR proteins, tomato I2 and Mi-1, have been demonstrated to be able to bind and hydrolyze ATP [34] and the ATP binding form...
- 20
- 269
- 0
Báo cáo y học: " High flow biphasic positive airway pressure by helmet – effects on pressurization, tidal volume, carbon dioxide accumulation and noise exposure" docx
... of helmet and airway (lung) flow and pressure during HF-BiPAP, BIVENT, and PSV Compliance was 90 ml/cm H2O, resistance was and airway (lung) flow and pressure during HF-BiPAP, BIVENT, and PSV cm ... contributions OM, PH, MQ, and PP planed and designed the study and developed the measurement setup OM, PH, and PP performed the measurements and analyzed the data PS and EC performed pilot studies ... Statsoft, Inc., and Microsoft Excel) Statistical analysis For all conditions, 15 measurements were obtained The data was presented as mean ± standard deviation (with median and 25th and 75th percentiles...
- 14
- 282
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25