gt igh thì sini gt sinigh áp dụng định luật khúc xạ ánh sáng ta có
Báo cáo y học: "Shift work as an oxidative stressor" pot
... data analysis Two blood samples were taken from each participant, one after their day shift and one after their night shift The blood samples were mixed with EDTA and frozen at 20°C The total ... http://www.jcircadianrhythms.com/content/3/1/15 Figure night total Mean shift plasma antioxidant capacity during day shift and Mean total plasma antioxidant capacity during day shift and night shift capacity was measured ... mean of total plasma antioxidant capacity at the end of day work was compared with the mean of total plasma antioxidant capacity at the end of night work by means of a paired t test Age, weight,...
- 3
- 278
- 0
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt
... cytoplasm of the cells Bar, 20 lm (D) The percentage of EGFP-containing cells displaying granules is shown The average percentages, including standard deviations calculated from three independent ... (transfected with pCIneo-EGFP) A representative experiment is presented The data from three independent experiments were used to perform statistical analysis (see Experimental procedures) (C) Electron microscopy ... in the previous figures) The data from three independent experiments were used to performed statistical analysis (see Experimental procedures) The asterisks denote statistical significance when compared...
- 18
- 721
- 0
C++ - I/O Streams as an Introduction to Objects and Classes
... file already contains data, that data is lost To append new output to the end an existing file use the constant ios::app defined in the iostream library: outStream.open("important.txt", ios::app); ... the_number; The input file must contain exactly the data expected Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 6- 31 Appending Data (optional) Output examples ... and over No typing of data again and again for testing Create a data file or read an output file at your convenience Files allow you to deal with larger data sets Copyright © 2007 Pearson Education,...
- 117
- 900
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected from interviews Quantitative analysis was done for primary data collected from the ... monitoring sales data in different areas The above internal analysis has shown the most important strengths and weaknesses of the Company as shown in Table 3.5: 28 Weaknesses Strengths Table 3.5: Summary ... non-tangible factors rather than tangible factors Therefore, branding has become a highly skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible...
- 67
- 974
- 0
THE INFORMAL SECTOR IN SOLID WASTE MANAGEMENT IN DEVELOPING COUNTRIES SUSTAINABILITY EFFECTS OF FORMALISATION CONSIDERING HO CHI MINH CITY – VIETNAM AS AN EXAMPLE
... All the data presented below is stated in % of wet weight, detailed data sheets can be found in Appendix IV: Composition at the sources The main characteristics of household waste are a high content ... an uncertainty about the real number of inhabitants in HCMC For instance, the Central Statistics Office quotes the population of HCMC at 5.073 million in 1999 (cp CSO, 2005), while the Statistical ... DEVELOPING COUNTRIES List of Tables TABLE 1: COLLECTED AND TREATED DOMESTIC SOLID WASTE PER CAPITA 33 TABLE 2: RENDEZVOUS POINTS (CP DONRE, 2003) 44 TABLE 3: CAPACITY OF THE MAIN...
- 112
- 593
- 5
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... like metallic toxins, ultraviolet radiation, or titanium dioxide photocatalysis Treatments with biocides are effective only if the installation is clean and there are no incrustations or stagnant ... and water and thus higher εs 3- Configuration of the humid surface: A humidifier that provides a higher area and time of contact between air and water permits obtaining higher values of εs In ... high heat-transfer areas in compact distributions [7] As the main resistance to heat-transfer can be found in the air on the dry face of the system, the advantage of the higher thermal conductance...
- 28
- 652
- 0
Tài liệu Understanding the Internet as an Infrastructure docx
... standard HTML controls as well, allowing you to manipulate them in your code Powerful Data controls for displaying, editing, and maintaining data from a database Options for caching client state ... feasible, but might require additional processing to reconcile client requests against state information and, of course, it would require some sort of database to persist that state information ... book, however New data source controls for binding data to Web pages These new controls allow you to build applications that can display and edit data quickly and easily The data source controls...
- 4
- 355
- 0
Tài liệu 27 Robust Speech Processing as an Inverse Problem docx
... unitary matrices and is a diagonal matrix The geometric interpretation is thus seen to be that x is rotated by unitary matrix VT , rescaled by the diagonal matrix , rotated again by the unitary ... cepstral distance can be related to the log spectral distance as ∞ c(n) − c (n) d= n=∞ = π −π log |S ej ω | − log |S ej ω | dω 2π (27.14) The cepstral distance is usually approximated by the distance ... magnitude of the high order cepstral coefficients is small and has a negligible contribution to the cepstral distance 27.4 Robust Speech Processing Robust speech processing attempts to maintain the performance...
- 19
- 433
- 0
Tài liệu Module 13: Using Excel as an OLAP Client docx
... external data source Click Get Data Microsoft Query starts and the Choose Data Source dialog box opens Click the OLAP Cubes tab and then click from the list Click OK BETA MATERIALS ... external data source Click Get Data Microsoft Query starts and the Choose Data Source dialog box opens Click the OLAP Cubes tab and then click from the list Click OK BETA MATERIALS ... PivotTable report based on that data source The Choose Data Source dialog box appears again Click OK Step of the PivotTable Wizard appears again Click Next and then click Finish A skeletal PivotTable...
- 38
- 319
- 0
Tài liệu Configuring Linux as an NIS Client ppt
... checks the bindings - IT Essentials II v2.0 - Lab 5.3.5 Copyright 2002, Cisco Systems, Inc The ypwhich daemon finds the NIS server Starting these daemons and configuring them to run automatically ... messages Reflection Configuring a Linux system can be very useful What are some circumstances in which using NIS might be beneficial? When would using NIS not be beneficial? ... this by pressing the Esc key Then type :wq and press the Enter key Step To run NIS as a client, start the ypbind and ypwhich daemons The ypbind daemon performs two functions, the master and the...
- 3
- 329
- 0
Tài liệu FOCUS ON DATA XMLPULL AS AN ALTERNATIVE TO DOM & SAX doc
... { // Going down $startRow = $startRow - $delta; $endRow = $startRow + $delta; if ( $startRow
- 63
- 496
- 1
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... Inhibition None Pepstatin A MA None Pepstatin A MA None Pepstatin A MA 100 100 0 100 15 These results support the data reported on T gondii infections [14], and suggest that the parasitostatic effect ... blood smears stained with Wright’s eosin methylene blue solution (Merck, Darmstadt, Germany), using the freely available plasmoscore software [56] to monitor the parasitaemia A detailed description ... silico target screening Our in silico target screening approach relies on the assumption that the set of bioactive ligands collected for a given target provides a complementary description of the target...
- 11
- 682
- 0
Tài liệu Cancer as an evolutionary and ecological process pptx
... nonmetastatic clones in the primary tumour owing to the loss of the progeny that emigrate How could a metastatic clone expand and produce enough metastatic cells to successfully colonize a distant ... progression88, mutations that confer a metastatic phenotype might also provide a fitness advantage within the primary tumour that can compensate for the loss of emigrating progeny Alternatively, metastatic ... selective advantage or disadvantage of a particular mutation and the size of the population of cells Some mutations might have no selective effect and are considered neutral If a particular mutation...
- 12
- 411
- 0
Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc
... contains the example sentences in itself, relevant sentences are retrieved at high speed and the retrieval function doesn't interrupt users' writing process Retrieved sentences, however, might ... Finally, users can also easily change articles to obtain the result sentence: 'Thank you for the present.' The system dictionary of "Eisaku Pen" contains about 100,000 Japanese vocabulary entries ... sentences Example sentences relevant to the texts input by users are retrieved from the database of "Reibun Bainda" containing 3,000 of Japanese-to-English bilingual sentence pairs for letter writing...
- 5
- 385
- 0
Báo cáo " Imperialism of communicative language teaching and possible resistance against it from teachers in Vietnam as an English foreign languages context " doc
... nhiên việc áp dụng đường hướng gặp phải khó khăn xuất phát từ phía giáo viên, sinh viên, người quản lí Trong khuôn khổ viết này, yếu tố giáo viên bàn đến để thấy phần tranh giảng dạy áp dụng đường ... Sato & Kleinsasser (1999) [8] state that different interpretations of CLT are originated from these different perspectives Therefore, 169 misconception of CLT is inevitable According to Thompson ... created It is also likely that sharing is not really important in the teachers’ mind Worse still, teachers feel uncomfortable or reluctant when their colleagues attend their class Teachers only...
- 8
- 736
- 2
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt
... 3) After 52 h, this mutant had formed higher-order aggregates which were stacked at the Ó FEBS 2004 Biochemical properties of a neuroserpin mutant (Eur J Biochem 271) 3363 Table Rate of polymerization ... by excitation at 295 nm The fluorescence spectra were measured with a PerkinElmer LS50B fluorimeter with both the excitation and emission slit widths set to 10 nm The spectrum data were obtained ... with mineral oil The proteins were visualized by staining with GelCodeÒ Blue Stain Reagent (Pierce, Tattenhall, Cheshire, UK) or by silver staining Unfolding of wild-type and Ser52Arg neuroserpin...
- 8
- 495
- 0
Báo cáo khoa học: Identification of versican as an isolectin B4-binding glycoprotein from mammalian spinal cord tissue pptx
... supernatant; lane 4, low-speed pellet; lane 5, high-speed supernatant; lane 6, high-speed pellet; lane 7, myelin; lane 8, light membranes; lane 9, synaptosomes; lane 10, mitochondria The highest ... Brilliant Bluestained gel: lane 1, native light membranes; lane 2, light membranes after a incubation with proteinase K; lane 3, light membranes after a incubation with proteinase K; lane 4, light membranes ... (TBS) containing 5% (w ⁄ v) dry milk and 0.1% (w ⁄ v) Tween 20] Lane 1, homogenate; lane 2, low-speed supernatant; lane 3, low-speed pellet; lane 4, high-speed supernatant; lane 5, high-speed...
- 13
- 447
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA ... GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom ... the percentages of cells in S-phase, G2 ⁄ M-phase and G1-phase, respectively) [35] Bioinformatics The miRNA targets predicted by computer-aided algorithms were obtained with pictar, targetscan,...
- 11
- 396
- 0
A Strategic Planning Approach - Defining Alternative Counterterrorism Strategies as an Illustration pot
... Defense FMF Foreign Military Financing (U.S State Department program) FY fiscal year IMET International Military Education and Training (U.S State Department program) MANPADS man-portable air-defense ... to strategic planning and to illustrate how it might be applied, including highlighting the challenges that might be encountered in its implementation Applying this approach in a real-world setting ... United States would provide assistance to improve the indigenous law-enforcement and military counterterrorism capabilities of these countries Means B: Provide operational military assistance to...
- 51
- 196
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008