gray iron a unique engineering material

Gray IronA Unique Engineering Material doc

Ngày tải lên : 06/07/2014, 05:20

23
258
0

Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efﬁciency, unlike the typical Dps proteins ppt

Ngày tải lên : 15/03/2014, 09:20

... with protparam (http://www.expasy.org). Removal of the His-tag A factor Xa cleavage site was created between the last amino acid (valine) and the His-tag. Cleavage by factor Xa occurs after an arginine, ... Listeria innocua. Biochem J 338, 71–75. 32 Havukainen H, Haataja S, Kauko A, Pulliainen AT, Salminen A, Haikarainen T, Finne J & Papageorgiou AC (2008) Structural basis of the zinc- and terbium- mediated ... with ferroxidase activity; the two iron atoms are at a dis- tance of about 3 A ˚ , and are connected by an oxo- bridge. The so-called A- site typically uses a histidine and carboxylates as iron- coordinating...

15
293
0

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): a unique metalloprotein ppt

Ngày tải lên : 16/02/2014, 15:20

1
363
0

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Ngày tải lên : 19/02/2014, 13:20

... fragment corresponding to an open reading frame (ORF) of EhPGDH was ampliﬁed by PCR using a cDNA library [26] as a template, and oligonucleotide primers (5Â-caGGATCCaagatagttgtgataac cga-3Â and ... protozoan parasite Entamoeba histolytica. Mol. Biochem. Parasitol. 97, 33–44. 27. Nozaki, T., Asai, T., Sanchez, L.B., Kobayashi, S., Nakazawa, M. & Takeuchi, T. (1999) Characterization of ... methionine c-lyase from Entamoeba histolytica: a key enzyme of sulfur-amino acid degradation in an anaerobic parasitic protist that lacks forward and reverse transsulfuration pathways. J. Biol. Chem....

12
464
0

Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt

Ngày tải lên : 20/02/2014, 11:20

... clearly showed that the majority of the material constituted of a tetrasaccharide and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... 4.98) was assigned to a 3-substituted 2-acetamido-4-amino- 2,4,6-trideoxy-galacto-pyranose (AAT) residue also with the a conﬁguration, as indicated from its J 1,2- value. The C-2 and C-4 in AAT were ... lipids and nucleic acids, gave two partially overlapping peaks that appeared at 1.3 (PSI) and 1.7 (PSII) void volumes in the eluate from a Sephacryl S-300 column. The unseparated material showed...

6
545
0

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Ngày tải lên : 07/03/2014, 02:20

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concentration necessary for 50% growth inhibition. Fungi ... kiharae seeds with a unique 10-cysteine motif Tatyana I. Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 ,...

10
505
0

Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt

Ngày tải lên : 08/03/2014, 02:21

... molecular mass of 118 kDa and a pI of 4.85, displayed a multidomain organization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding module, and a putative ﬁbronectin-III ... cellulase among Bacillales Marta M. Sa ´ nchez, F. I. Javier Pastor and Pilar Diaz Department of Microbiology, Faculty of Biology, University of Barcelona, Spain Sequence analysis of a Paenibacillus ... domain. The cloned cellulase, unique among Bacillales and designated Cel48C, was puriﬁed through a nity chromatography using its ability to bind Avicel. Maximum activity was achieved at 45 °C and...

7
404
0

Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

Ngày tải lên : 08/03/2014, 08:20

... Cerebratulus californiensis and Cerebratulus lacteus. J Exp Zool 290, 431–436. 16 Munoz-Guerra S, Azorin F, Casas MT, Marcet X, Maristany MA, Roca J & Subirana JA (1982) Structural organization ... Universitat Polite ` cnica de Catalunya, Barcelona, Spain 2 Departament de Cie ` ncies Fisiolo ` giques II, Facultat de Medicina, Universitat de Barcelona, L’Hospitalet de Llobregat, Spain 3 Departamento ... source are also indicated. This material is available as part of the online article from http://www.blackwell-synergy.com N. Saperas et al. Protamine-like proteins and chromatin FEBS Journal 273...

14
484
0

Mechanical behaviour of engineering materials

Ngày tải lên : 14/03/2014, 12:13

... a material is loaded with a force, the atoms within the material are dis- placed – the material responds with a deformation. This deformation deter- mines the mechanical behaviour of the material. ... fellowship at the University of California, Santa Barbara, usa, he worked at Asea Brown Boveri ag, Switzerland, from 1991 to 1996, being ﬁnally responsible for the material laboratory of abb Power ... His main research interest lies in high-temperature materials, the mechanical behaviour of materials, and in m aterials develop- ment. Dr Ing. Harald Harders, born in 1972, studied mechanical engineering, with...

540
397
0

Engineering Materials 2An Introduction to Microstructures, Processing and Design ppt

Ngày tải lên : 14/03/2014, 14:20

... Because aluminium is * One thinks of aluminium as a cheap material – aluminium spoons are so cheap that they are thrown away. It was not always so. Napoleon had a set of cutlery specially made ... make from copper and zinc. A binary alloy has two components; a ternary alloy has three. A phase is a region of material that has uniform physical and chemical properties. Phases are often given ... but we can’t of course say from the phase diagram what the relative weights of the three phases are. Other phase diagrams Phase diagrams have been measured for almost any alloy system you are likely...

392
1.4K
0

Báo cáo khoa học: GRAIL: a unique mediator of CD4 T-lymphocyte unresponsiveness ppt

Ngày tải lên : 15/03/2014, 00:20

... inositol phosphate, calcium, and tyrosine kinase signaling pathways. Proc Natl Acad Sci USA 91, 38–42. 44 Hundt M, Tabata H, Jeon MS, Hayashi K, Tanaka Y, Krishna R, De Giorgio L, Liu YC, Fukata M & Altman ... signaling, and ultimately, mammalian target of rapamycin (mTOR)- dependent translation of select mRNA ([24] and unpublished data) (Fig. 3). In particular, IL-2R signaling leads to Akt and mTOR activation, ... in dysregulated differentiation. Acta Haematol 122 , 230– 237. 64 Nakamichi S, Senga Y, Inoue H, Emi A, Matsuki Y, Watanabe E, Hiramatsu R, Ogawa W & Kasuga M (2009) Role of the E3 ubiquitin ligase...

12
337
0

Báo cáo khoa học: "A KNOWLEDGE ENGINEERING APPROACH TO NATURAL LANGUAGE UNDERSTANDING" pot

Ngày tải lên : 17/03/2014, 19:21

... NOUN. ** 'BAR IS A NOUN. *~ 'FLUID IS A MASS-NOUN. ** &apos ;MATERIAL IS A MASS-NOUN. ** 'MILK IS A MASS-NOUN. ** 'WATER IS A MASS-NOUN. ** 'GLASS IS A MASS-NOUN. ... be available to the theorist as domain knowledge. As a result of our preliminary study of a KE approach to Natural Language Understanding, we have gained valuable experience with the basic ... ** 'Y IS A VARIABLE. ** 'ON IS A RELATION. ** &apos ;A IS A G-DETERMINER. ** 'BOTTLE IS A NOUN. ** 'CONTAINER IS A NOUN. ** 'TABLE IS A NOUN. ** 'DESK IS A NOUN....

9
426
0

engineering materials 2e volume1 potx

Ngày tải lên : 22/03/2014, 12:20

... of about 104GPa. Practical engineering materials lie in the range lo” to 10+3GPa - a 22 Engineering Materials 1 Tabla 2.4 Approximate energy content of materials GJ tonne-' ... total available material. Resources are almost always much larger than reserves, but because the geophysical data and economic projections are poor, their evaluation is subject to vast uncertainty. ... solid materials available to us are silicates and alumino-silicates. A few metals appear on the list, among them iron and aluminium both of which feature also in the list of widely-used materials....

322
376
1

Engineering Materials 2An pptx

Ngày tải lên : 22/03/2014, 12:20

... aluminium as a cheap material – aluminium spoons are so cheap that they are thrown away. It was not always so. Napoleon had a set of cutlery specially made from the then-new material. It cost ... 8 Engineering Materials 2 Fig. 1.4. Miniature boiler ﬁttings made from brass: a water-level gauge, a steam valve, a pressure gauge, and a feed-water injector. Brass is so easy to machine that ... also a change in chemical composition (Fig. 2.5d). Such a phase boundary has a high energy – comparable with that of a grain boundary – and around 0.5 J m −2 . Shapes of grains and phases Grains...

392
1.1K
0

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Ngày tải lên : 22/03/2014, 21:20

... was ampliﬁed by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5Â- CATATGGATGAGTACAAACA AGTAGATG-3Â and reverse primer 5Â- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3Â ... 2433–2439. 11 Wada K, Hiratake J, Irie M, Okada T, Yamada C, Kumagai H, Suzuki H & Fukuyama K (2008) Crystal structures of Escherichia coli c-glutamyltranspeptidase in complex with azaserine and acivicin: ... metabolism, and its reaction intermediate. Proc Natl Acad Sci USA 103, 6471–6476. 9 Boanca G, Sand A, Okada T, Suzuki H, Kumagai H, Fukuyama K & Barycki JJ (2007) Autoprocessing of Helicobacter...