glinski elena c 1506 1538 grand princess of moscow

Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object

Ngày tải lên : 12/01/2014, 16:56

... c u tr c tr c C c bư c s d ng: ng: Khai báo l p (file h): t o ki u cho đ i tư ng ng class p> { ; tính>; ; c> ; }; C i đ t l p (file cpp): c i ... Nguy n Minh Huy 13 T mv c Dr Guru khuyên: khuyên: Quy t c h p đen: đen: Thu c tính c t m v c private đ h n ch truy xu t t Phương th c có t m v c public đ cung c p tính năng class PhanSo { private: ... ng l p Đ i tư ng gì? gì? Chương trình c máy” ph c t p máy” p C u thành t nhi u lo i “chi ti t” t” Chi ti t b n: hàm, c u tr c n: hàm, tr c Đã đ t o chương trình t t? t? Chi ti t m i: Đ i tư ng!!...

22
538
5

Tài liệu TRUYỆN CỔ TÍCH ANH NGỮ ( KO CÓ BẢN DỊCH) The Princess of the Golden Island doc

Ngày tải lên : 20/01/2014, 23:20

... patience, courage, and love Your princess must pass all three tests to become our ruler." The day of the tests arrived The princess entered the room Her uncle said the first test was patience "Here ... servant The princess grew up The leaders of the kingdom called a meeting They said, "It is time for the princess to rule the country." Majka's uncle was angry "There is a law in our country," he ... little princess was alone She began to cry A large black bird flew in the window She told him the problem The bird flew out to the garden "All birds, come to help! Help our little princess! "...

4
687
2

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Ngày tải lên : 21/02/2014, 00:20

... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because ... afﬁnity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6]...

8
616
0

Tài liệu Báo cáo Y học: Use of site-speciﬁc recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20

... sites I of res as direct repeats, instead of two full res gd102NLS is also proficient to recombine sites I in the absence of accessory sites The efficiency of this reaction is significantly reduced, ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds ... Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells Nucleic Acids...

7
472
0

A Princess of Mars ppt

Ngày tải lên : 06/03/2014, 14:20

... a variety of hops which took me clear of the ground a couple of feet at each step and landed me sprawling upon my face or back at the end of each second or third hop My muscles, perfectly attuned ... approach of a score of full-grown Martians from behind me Coming, as they did, over the soft and soundless moss, which covers practically the entire surface of Mars with the exception of the ... nailless, which fact had also contributed to the noiselessness of their approach, and, in 18 common with a multiplicity of legs, is a characteristic feature of the fauna of Mars The highest type of man...

168
481
0

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Ngày tải lên : 07/03/2014, 05:20

... the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... part of the ﬁgure Dimer, dimeric M-MUC5AC-CH; Monomer, monomeric M-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- terminal cleavage fragment; M -C1 , N-terminal cleavage fragment The position of...

9
330
0

Báo cáo Y học: Human immunoglobulin A (IgA)-speciﬁc ligands from combinatorial engineering of protein A ppt

Ngày tải lên : 08/03/2014, 23:20

... insertion of a linker sequence formed by the oligonucleotides ZlibHisStop-1: 5¢-TCGACCCATCAT CATCATCATCATTAATAAGTCGAC-3¢ and ZlibHisStop-2: 5¢-TCGACGTCGACTTATTAATGATGATGA TGATGATGATGGG-3¢ encoding ... reference surface (ABD) was used to produce subtractive sensorgrams IgA-speci c aﬃbody ligands (Eur J Biochem 269) 2649 Construction and production of dimeric (head-to-tail) afﬁbody constructs The ... therapeutic use are currently under investigation in clinical trials [34] The majority of those are of IgG isotype, which can effectively activate complement- and antibodydependent cellular cytotoxicity...

9
579
0

Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

Ngày tải lên : 16/03/2014, 06:20

... aI22 3C ⁄ cV5 8C aI22 3C ⁄ cL5 9C aN23 0C ⁄ cS6 6C aN23 0C ⁄ cT6 7C aN23 0C ⁄ cG6 8C aN23 0C ⁄ cI6 9C aN23 0C ⁄ cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C ... aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C aL24 0C ⁄ cI7 7C aL24 1C ⁄ cL7 6C aL24 1C ⁄ cI7 7C aL20 7C ⁄ cF5 4C aL20 7C ⁄ cI5 5C aN21 4C ⁄ cA6 2C aN21 4C ⁄ cI6 3C aN21 4C ... cI6 3C aN21 4C ⁄ cP6 4C aN21 4C ⁄ cM6 5C aN21 4C ⁄ cI6 6C aA21 7C ⁄ cM6 5C aA21 7C ⁄ cI6 6C aI22 1C ⁄ cG6 9C aI22 3C ⁄ cL7 2C aI22 3C ⁄ cY7 3C aL22 4C ⁄ cL7 2C aL22 4C ⁄ cY7 3C aI22 5C ⁄ cL7 2C aI22 5C ⁄ cY7 3C ++++ +++...

14
592
0

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Ngày tải lên : 23/03/2014, 17:22

... residue of Rha at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS-II were essentially identical, and ... O-polysaccharide from Citrobacter braakii O6 (Eur J Biochem 270) 2735 Fig Part of a two-dimensional 1H,1 3C HSQC spectrum of the O-speci c polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional ... OPS of Citrobacter (Fig 3) One, from Citrobacter PCM 1487 and PCM 1528 (O5), is built up of branched trisaccharide repeating units, in which D-ara4dHex is attached as a sidechain to a GlcNAc residue...

7
478
0

Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx

Ngày tải lên : 24/03/2014, 04:20

... academic as well as practical exposure and we look forward to more of such visits in future to enhance both our theoretical, technical and practical knowledge Alcoholic Beverages An alcoholic ... The consumption of alcohol is often important at social events in such societies and may be an important aspect of a community's culture The concentration of alcohol in a drink may be specified ... Danish scientist Hansen Nowadays there are two main varieties of yeasts that are used in brewing: saccharomyces cerevisiae and saccharomyces carlsbergensis (bottomfermenting) Certain other products...

20
323
0

egbers c., pfister g. (eds.) physics of rotating fluids

Ngày tải lên : 24/04/2014, 16:47

... include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these singularities may be found in Cliﬀe ... of experience guarantee authors the best possible service To reach the goal of rapid publication at a low price the technique of photographic reproduction from a camera-ready manuscript was chosen ... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings...

445
774
0

lawrie i.d. unified grand tour of theoretical physics

Ngày tải lên : 24/04/2014, 17:10

... spacetime wavefunction spacetime coordinate of the point (τ, σ ) on the worldsheet of a relativistic string fugacity canonical and grand canonical partition functions spin connection symplectic ... mechanics into quantum mechanics We have discovered, amongst other things, that electrons can be diffracted by crystals: a phenomenon for which quantum mechanics can account but classical mechanics ... permission of the publisher Multiple copying is permitted in accordance with the terms of licences issued by the Copyright Licensing Agency under the terms of its agreement with the Committee of Vice-Chancellors...

580
966
0

oakley c.g. quantum field theories of arbitrary spin

Ngày tải lên : 24/04/2014, 17:21

53
235
0

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Ngày tải lên : 18/06/2014, 18:20

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...

12
354
0

The Legend of Princess of Lieu Hanh

Ngày tải lên : 01/07/2014, 21:00

... and inscribe two characters therein Two courtiers then conducted the unfortunate maiden towards a door over which was written in golden characters "EXILE BY IMPERIAL DECREE." This inscription ... later the princess took sick and died After his wife's death, the mandarin was rarely seen at court He spent most of his time in the princess' s little palace, where he could sit at the edge of the ... Immortals The rumble of the sea was heard beneath the purple slopes of Mt Hoanh Son, the home of flocks of colorful herons The little village of Ton Huong was backed against a hill covered with fragrant...

5
292
0

Designation: C 25 – 99 - Chemical Analysis of Limestone, Quicklime, and Hydrated Lime1 pptx

Ngày tải lên : 10/07/2014, 23:20

... concentrations are intended: Acetic acid (HC2H3O2) Hydrochloric acid (HCl) Hydroﬂuoric acid (HF) Nitric acid (HNO3) Perchloric acid (HClO4) Phosphoric acid (H3PO4) Sulfuric acid (H2SO4) Ammonium hydroxide ... be calculated 30.2 Summary of Test Method—Determine the percent of free water, LOI, CO2, SO3, CaO, and MgO in accordance with the preceding sections Calculate combined H2O, calcium carbonate, calcium ... introduction of traces of organic matter due to the action of the hot sulfuric acid on the paper; these would consume KMnO4 and give high results for CaO 17.5 Calculation—Calculate the percentage of CaO...

36
692
1

Designation: C 109/C 109M – 99 - Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)1 pps

Ngày tải lên : 10/07/2014, 23:20

... curvature, grind the face or faces to plane surfaces or discard the specimen A periodic check of the cross-sectional area of the specimens should be made NOTE 7—Specimen Faces—Results much lower than ... specimens in water at a temperature of 73.56 3.5°F or [23 2 C] and of sufficient depth to completely immerse each specimen until time of testing 10.6.2 Wipe each specimen to a surface-dry condition, ... head of the machine The center of the sphere shall lie at the center of the surface of the block in contact with the specimen The block shall be closely held in its spherical seat, but shall be...

6
487
2

Designation: C 110 – 00 - Physical Testing of Quicklime, Hydrated Lime, and Limestone1 doc

Ngày tải lên : 10/07/2014, 23:20

... Mixing of Mortars—Mix the mortar in accordance with the procedure for mixing pastes in Practice C 305 13.3.3 Determination of Flow—Determine the ﬂow in accordance with the Procedure section of Test ... 20 C; variations from this temperature produce inaccuracy in the hydrometer reading; (2) Speci c gravity: Addition of dispersant changes the speci c gravity of the solution; (3) Meniscus correction: ... method covers the determination of the speci c gravity of hydrated lime The speci c gravity of hydrated lime is needed for calculations of air content (see Section 13) and Blaine Surface Area 21 Commercially...

19
432
0

Designation: C 114 – 00 - Chemical Analysis of Hydraulic Cement1 pot

Ngày tải lên : 10/07/2014, 23:20

... it through a cheap desiccant, such as calcium chloride or sulfuric acid, followed by a desiccant of high efficiency, such as magnesium perchlorate or anhydrous calcium sulfate, with care taken ... If desired calculate the percentage of CaO corrected for SrO as follows: CaOc % CaOi % 0.54 SrO % (5) where: CaOc CaO corrected for SrO, and CaOi initial CaO as determined in 13.4.1 CaO 56.08 ... Reagent Chemicals, American Chemical Society Speciﬁcations, American Chemical Society, Washington, DC For suggestions on the testing of reagents not listed by the American Chemical Society, see...

30
876
1