giving your verbal skills a workout with practice questions
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
Ngày tải lên :
07/11/2012, 15:06
... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based...
- 40
- 644
- 1
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE
Ngày tải lên :
07/09/2013, 13:41
... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based...
- 40
- 420
- 0
two-word phrasal verbs with the particle in that require into when used with an object
Ngày tải lên :
01/11/2013, 16:20
... things have been a bit confused at our office lately broken in part.adj After you break in a new mechanical device or a car, a pair of shoes, or people at a new job, they are broken in l don't want ... give your luggage to an airline agent so that it will be carried in the baggage compartment rather than the passenger compartment, you check it in 315 That bag is too big for carry-on — you'll have ... phrasal verbs with get, Many phrasal verbs are based on the verb get, and it is important to understand that the meaning of get in these verbs is not the same as the nonphrasal form of get, meaning...
- 17
- 633
- 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx
Ngày tải lên :
20/02/2014, 02:21
... GATGCCAATGCTGACATCAAC-3¢ for His145Asn and 5¢-TGACATCGACACACCCC-3¢ for Asn149Asp Fluorescence spectra and thermal inactivation studies Fluorescence measurements were made at 25 °C on a Shimadzu ... totally different substrate specificities, is considered for arginase and agmatinase [20] Such substrate discrimination is particularly important for mammalian arginase II and agmatinase, as both ... required for maximal catalysis by both enzyme forms [9] Mammalian and all other known arginases also shares a significant sequence homology with all sequenced agmatinases (agmatine ureo hydrolase, EC...
- 9
- 651
- 0
Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx
Ngày tải lên :
21/02/2014, 05:20
... summary or roadmap paragraphs In those studies, headings are also called “signaling topic structures” and summaries or roadmaps are called “advance organizers.” Both signals and advance organizers ... Tinker and Paterson reached involved the use of capitalization Contrary to what many people might think, the use of all capital letters in a heading (“all caps”) actually dramatically decreases ... groundwork for memory Advance organizers such as roadmaps or summaries create a learning base that the reader can call upon as pre-learned material when later introduced to the material in more depth.84...
- 45
- 646
- 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
Ngày tải lên :
16/03/2014, 14:20
... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... which have a homo-dimeric or -tetrameric structure with domain N acting as a connector By contrast, TVAI adopts a monomeric structure with domain N, a starch-binding domain, acting as an anchor ... Henrissat B (1991) A classification of glycosyl hydrases based on amino acid sequence similarities Biochem J 280, 309–316 Tonozuka T, Mogi S, Shimura Y, Ibuka A, Sakai H, Matsuzawa H, Sakano Y & Ohta...
- 9
- 342
- 0
Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt
Ngày tải lên :
08/08/2014, 23:20
... The base omitted factors are SF < 1/year, SF > 1/year, CFE, IGE, AED1, AED2, AED 3, age and disease duration tions have clearly established that partial seizures, particularly complex partial seizures ... evaluation Statistical analysis Continuous data are presented as mean ± standard deviation (SD) while non-continuous variables are given as percentages In order to assess which factors are independently ... independently associated with BDI-21, STAI-S and STAI-T, a two-step approach was adopted As a first step, simple regression analyses were performed with various factors such as age, gender, the...
- 8
- 290
- 0
Báo cáo y học: " A case of spotted fever group rickettsiosis imported into the United Kingdom and treated with ciprofloxacin: a case repor" pptx
Ngày tải lên :
11/08/2014, 23:21
... eschar with associated regional lymphadenopathy – as occurred in our patient – makes the diagnosis of African tick bite fever highly probable As is the case with most common rickettsioses, African ... normal and malarial films were negative C-reactive protein was slightly raised at 29 Blood samples were collected for serological studies on initial presentation and weeks later (Table 1) A working ... day of therapy, therapy was changed to ciprofloxacin, and a rapid response was then observed Previous reports of clinical failure with doxycycline are rare Jensenius et al [3] reported that a...
- 3
- 347
- 0
Insights into the mechanism of safingol and its potential to synergize with anti cancer drugs
Ngày tải lên :
11/09/2015, 10:02
... xii List of Abbreviations 2-NBDG 3-MA 5-FU 7AAD Abs AIF ANOVA ANT AMPK APAF-1 APP Ara-C Apo2-L Atg ATP AVO BA1 Bcl-2 BH BSA CD95 Cdk Chk CI CMA 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2deoxyglucose ... such as Fas-associated death domain (FADD), which interacts with pro-caspase and 10 to form the death-inducing signaling complex (DISC) Pro-caspase and 10 are self-cleaved Activated caspase and ... membrane (phagophore) Atg activates Atg 12 and Atg 12 is transferred to Atg 10 before conjugates with Atg Then, Atg 16 conjugates to Atg12-Atg5 and attaches Atg12-Atg5-Atg16 complex to phagophore...
- 166
- 459
- 0
Tapping into the Power of Text Mining
Ngày tải lên :
31/08/2012, 16:46
... Statistics has its grounds in mathematics and deals with the science and practice for the analysis of empirical data It is based on statistical theory which is a branch of applied mathematics Within ... instance, data in a database, but also data in a simple text file Characteristics that can be used to measure the quality of the patterns found in the data are the comprehensibility for humans, validity ... and ultimately understandable patterns in data” The analysis of data in KDD aims at finding hidden patterns and connections in these data By data we understand a quantity of facts, which can be,...
- 37
- 1.3K
- 3
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
Ngày tải lên :
25/10/2012, 11:18
... Ltd Tokyo, Japan) Statistical analysis Data were expressed as means ± standard deviation (SD), and comparisons were performed with Wilcoxon rank sum test All statistical analyses were carried out ... vacuolated, and mitochondria swelled to a circular shape with a clear matrix and short or disappeared cristae, which were vacuolar appearances Smooth and rough endoplasmic reticulum expanded and became ... The minimal invasiveness and accurate targeting with a real-time US guide allow HIFU to precisely ablate lesions of large size, irregular shape, and even multi-modularity A major advantage of HIFU...
- 7
- 481
- 0
Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"
Ngày tải lên :
26/10/2012, 08:57
... GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT 3’) primers were used as published (24) µl of DNA was added to reaction mixture containing ... serum was immediately separated and stored at - 80° C until assayed C.pneumoniae-specific IgA and IgG antibodies were evaluated by using Chlamydia pneumoniae-IgG-ELISA medac plus and Chlamydia pneumoniae-IgA-ELISA ... 5'-TGCGGAAAGCTGTATTTCTACAGTT-3'; and TaqMan probe 557, 5'-TCCAGGTAAGGTCC TTCGCGTTGCATCG-3') generated a PCR product of predicted size (194 bp) The TaqMan probe was labelled at the 5' end with 6-carboxyfluorescein...
- 10
- 782
- 0
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
Ngày tải lên :
07/11/2012, 14:50
... functions Chapter provides theoretical background about Communicative Language Teaching, speaking skills, three main stages of speaking and motivation in a speaking lesson Chapter investigates the ... (please specify) 11 What you while students practice Speaking? A Help students with useful vocabulary and structures B Go around the class to monitor C Stay at your seat and relax D Take ... speaking materials and appropriate time for teaching and learning English speaking 24 Table 4: Pre-speaking activities carried out by teachers and students’ responses 26 Table 5: While-speaking activities...
- 20
- 2.4K
- 27
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines
Ngày tải lên :
07/11/2012, 14:54
... Germany Lufthansa There's no better way to fly 33 Malaysia Airlines Malaysia Going beyond expectations 34 Northwest Airlines 35 Pakistan International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas ... Air Canada Canada World class, worldwide Air France France Air France One of the best places on earth AIR INDIA India New Zealand your place in the sky Being there is everything Air New Zealand ... “wings”, “the air”, “up” and so on Alitalia The wings of Italy -AlitaliaYour Island in the Sky -Air PacificSomething special in the air -American Airlines- Use of geographical names and brand names 29...
- 45
- 1.4K
- 10