getting energy and a cleaner environment with nanotech
english adjective antonyms and a contrative analysis with those in vietnamese
Ngày tải lên :
20/12/2013, 18:16
... and learning English III.1 Application We can apply adjective antonyms in teaching and learning vocabulary, grammar and writing, reading III.1.1 Vocabulary There are too many adjective antonyms ... not the same as that for all animals in general, the elephant which is small in comparison with other elephants may be big in comparison with animals as a class The semantic polarity in antonyms ... in meaning E.g married and single awake and asleep big and small They are antonyms But considering the words "big "and "red", they are not antonyms because they have too few semantic features...
- 55
- 1.1K
- 16
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
Ngày tải lên :
20/12/2013, 18:33
... example: with a high hand (in a haughty way) This idiom cannot be shortened in any circumstances, we also cannot say with a tall hand although high and tall are similar In contrast, a proverb is ... effective and interesting way because they contain not only the literal meanings but the figurative and expressive meanings as well They are an integral part of a language and they make the language ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay,...
- 54
- 1.8K
- 13
Báo cáo y học: "A neurotropic herpesvirus infecting the gastropod, abalone, shares ancestry with oyster herpesvirus and a herpesvirus associated with the amphioxus genome" pps
Ngày tải lên :
12/08/2014, 02:20
... (Haliotis laevigata and Haliotis rubra) Australian Veterinary Journal 2007, 85:188-193 NACA: Quarterly Aquatic Animal Disease Report (Asia and Pacific Region) 2006/1 Book Quarterly Aquatic Animal ... Sawbridge TI, Fegan M, et al: Development and validation of a TaqMan PCR assay for the Australian abalone herpes-like virus Dis Aquat Organ 2010, 91:1-10 Davison AJ, Eberle R, Ehlers B, Hayward ... Herpesviridae in vertebrates indicate a divergence of alpha-, beta- and gammaherpesviruses to over 400 Mya, and longer times are predicted for divergence of Alloherpesviridae and Malacoherpesviridae[7]...
- 9
- 261
- 0
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc
Ngày tải lên :
13/08/2014, 01:20
... Park, Singapore) as described [15,25] mo 166 HTLV-1 TAX IR CTTRACAAACATGGGGAGGAAAT mo 013 B2M OF TAGAGGTTCCCAGGCCACTA mo 014 B2M OR ACCATGTAGCCTATGCGTGT mo 015 B2M IF ACAAGGAGCTCCAGAAGCAA mo 016 ... knowledge about an ancient infection Lancet Infect Dis 2007, 7:266-281 Sagawa K, Mochizuki M, Masuoka K, Katagiri K, Katayama T, Maeda T, Tanimoto A, Sugita S, Watanabe T, Itoh K: Immunopathological ... HIV-negative persons) Statistical methods Data were double entered in an Access (Microsoft, Redmond, WA, USA) database and validated The analysis was performed using Stata 11 (Stata Corporation,...
- 9
- 336
- 0
Báo cáo sinh học: "Genetic evaluation for a quantitative trait controlled by polygenes and a major locus with genotypes not or only partly known" doc
Ngày tải lên :
14/08/2014, 19:22
... Consider a quantitative trait which is controlled by autosomal major locus with alleles, A and a, and many other unlinked loci with alleles of small effects Mendelian segregation is assumed for all alleles ... which is a natural deduction from !14! The linear model can be written in matrix notation as: et al (1993) assumed that Var (a ) * Var (a) A - Q and Var(e ) = * a I - Q The matrices Q and W are not ... the data, whereas the other methods used [13] Additional simulation runs with parameter sets and and approximations [9] and [11] together with [6] showed considerably lower estimates of p and...
- 19
- 236
- 0
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
Ngày tải lên :
15/10/2013, 16:10
... IGBTs (a) Time-trends of voltage sharing of three IGBTs for the case of 1000 Hz and 100 A (b)Configuration [2] K Shimada, T Takaku, T Matsukawa, and R Shimada, “Bi-directional current switch with ... 2007 T Takaku, N Iwamuro, Y Uchida, and R Shimada, “Experimental demonstration of 1200V IGBT for a magnetic energy recovery switch application,” IEEJ Transaction on Electronics, Information and Systems, ... be cancelled and the output power increased A requirement for such a compensator is that it shall be able to operate during variable speed and not cause any resonant problems The configuration...
- 8
- 888
- 1
Báo cáo hóa học: " Research Article A Feedback-Based Transmission for Wireless Networks with Energy and Secrecy Constraints" potx
Ngày tải lên :
21/06/2014, 05:20
... Communications and Networking B The PDF of the Random Variable A/ f ∗ Let f ∗ be a random variable that is equal to the maximum among K i.i.d exponential random variables with a parameter λ f If A ... source message against potential attacks The second approach uses more efficiently the available channel feedback and extracts the MUD gain by employing an adaptive PA scheme This adaptive PA adjusts ... Chapter 6] with an appropriate PA scheme under a target outage probability constraint The first transmission approach employs a constant PA scheme and uses the MUD gain in order to save energy and...
- 11
- 501
- 0
How to be a good steward of energy and the environment potx
Ngày tải lên :
29/06/2014, 04:20
... here are some average annual household expenditures: $1,764 What Is Cap and Trade? Under a cap -and- trade program, each power plant, factory, refinery, and other regulated entity would be allocated ... losses, and higher energy prices Increases The Heritage Foundation The Economy Hits Home: Energy and the Environment 11 CAP & TAX: Top Ten Problems with Cap and Trade Cap and trade is a massive energy ... schemes are as simple as placing a tax on carbon emissions, while others, such as “cap and dividend” or “cap and invest,” are really variations of the original Take cap and dividend Under this plan,...
- 15
- 462
- 0
Báo cáo y học: "Circadian phase-shifting effects of a laboratory environment: a clinical trial with bright and dim light" ppsx
Ngày tải lên :
10/08/2014, 09:20
... ages 20–40), mean and SE Age Group Baseline aMT6s Acrophase Final aMT6s Acrophase Baseline Circadian Malsynch Final Circadian Malsynch Baseline Circadian Dispersion Final Circadian Dispersion ... Journal of Circadian Rhythms 2005, 3:11 Figure Circadian malsynchronization at baseline and final assessment Circadian malsynchronization at baseline and final assessment Shown is circadian malsynchronization, ... differed, on average, by 0.03 hours Baseline aMT6s acrophase was compared across treatment and age group via × ANOVA Final aMT6 acrophase was determined from urinary data collected during the final 24–30...
- 9
- 462
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
Ngày tải lên :
10/04/2013, 14:46
... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
- 44
- 1.8K
- 7
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
Ngày tải lên :
05/09/2013, 16:10
... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square ... rectangular duct Int Journal of Heat and Mass Transfer1999; 42: 1597-1615 [16] Karwa R, Experimental studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with...
- 12
- 831
- 0
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source
Ngày tải lên :
05/09/2013, 16:10
... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... International Journal of Energy and Environment (IJEE), Volume 1, Issue 3, 2010, pp.467-478 transfer past a vertical porous plate with variable temperature Ogulu and Prakash [15] discussed the heat ... Unsteady free convective MHD flow and mass transfer past a vertical porous plate with variable temperature Bull Cal Math Soc.2005, 97 (2), 137-146 [15] Ogulu A. , Prakash J Heat transfer to unsteady...
- 12
- 428
- 0
Tài liệu Debugging C and C++ code in a Unix environment ppt
Ngày tải lên :
21/01/2014, 06:20
... called Using the compiler’s features Explicit storage allocation and deallocation In C and C++, you have to explicitly allocate and deallocate dynamic storage through malloc and free (for C) and ... the C and C++ languages and the associated build process that often lead to problems Preprocessor C and C++ use a preprocessor to expand macro’s, declare dependencies and import declarations and ... section called An example makefile in Appendix A for a way to track dependencies automatically • Basic semantic bugs, such as using uninitialised variables, dead code and certain type problems A compiler...
- 29
- 466
- 1
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
- 14
- 517
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
Ngày tải lên :
06/03/2014, 08:21
... ⊕6 A · gi , i=1 where g1 = and g2 , g3 , , g6 can be chosen to be homogeneous of degree 5, 6, 6, 7, 12 (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants ... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an ... successive maxima and Remark 3.2 rather than just Lemma 3.1 This seems like an interesting optimization question; the gain for small n can be significant although one does not obtain an exponent near Proof...
- 20
- 478
- 0
THE ARTS CHILD POLICY CIVIL JUSTICE EDUCATION ENERGY AND ENVIRONMENT HEALTH AND HEALTH CARE docx
Ngày tải lên :
06/03/2014, 09:21
... and cultural variation (Africa, Latin America, Central Asia, the Balkans, the Far East), and variation in the military capabilities of COIN forces and insurgent forces alike Twenty distinct approaches ... contains a case narrative for each of the 30 COIN cases, along with a tabular presentation of the data scores for all factors for each phase of each case.6 See Paul, Clarke, and Grill, 2010 CHAPTER ... para la Liberación Nacional [Farabundo Martí National Liberation Front] fsQCA fuzzy-set Qualitative Comparative Analysis (software) GIA Groupe Islamique Armé [Armed Islamic Group] HV Hrvatska Vojska...
- 187
- 309
- 0
CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
Ngày tải lên :
06/03/2014, 13:20
... falls away and shows the body as it had been bared for the scourging It is a beautiful form, perfectly developed, and the arms and hands are as delicately modelled as a woman's The face is oval, ... Madonna della Scodella) Before the child Jesus was two years old, he was taken on a journey which at that time was long and tedious An angel appeared to Joseph one night in a dream, saying, "Arise, ... describes an artist's meditations while trying to draw a hand [18]His failure teaches him to realize that he must study the "Flesh and bone and nerve that makeThe poorest coarsest human handAn object...
- 87
- 566
- 0
IMPLEMENTING THE NEW BIOLOGY Decadal Challenges Linking Food, Energy, and the Environment pptx
Ngày tải lên :
06/03/2014, 19:20
... INDIA HOOK-BARNARD, Program Officer ANNA FARRAR, Financial Associate CARL-GUSTAV ANDERSON, Senior Program Assistant AMANDA MAZZAWI, Senior Program Assistant SAYYEDA AYESHA AHMED, Program Assistant ... discussed a “Plan A and a “Plan B”: Plan A to achieve a carbon-neutral environment; if not, Plan B to learn how to adapt to a non-carbon-neutral environment and to accelerate the time scale of that adaptation ... hectares of abandoned agricultural land may be available in the United States This land, such as overgrazed pastureland in the Southwest, often has road access or some infrastructure in place...
- 52
- 342
- 0