0

getting a grip on grammar and usage

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Thạc sĩ - Cao học

... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... satisfying basic physical and psychological needs, and that cultural patterns are interrelated and tended mutually to support need satisfaction * Goal = Exploration- The student can evaluate a...
  • 40
  • 644
  • 1
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING   CONTRASTING APPROACH a CASE OF TOURISM STUDE

INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE

Khoa học xã hội

... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... satisfying basic physical and psychological needs, and that cultural patterns are interrelated and tended mutually to support need satisfaction * Goal = Exploration- The student can evaluate a...
  • 40
  • 420
  • 0
two-word phrasal verbs with the particle in that require into when used with an object

two-word phrasal verbs with the particle in that require into when used with an object

Ngữ pháp tiếng Anh

... When you break in a pair of shoes, you wear them only occasionally and for a short time until they are comfortable When you break in people at a new job, you train and supervise them and give them ... things have been a bit confused at our office lately broken in part.adj After you break in a new mechanical device or a car, a pair of shoes, or people at a new job, they are broken in l don't want ... FOCUS ON: phrasal verbs with get, Many phrasal verbs are based on the verb get, and it is important to understand that the meaning of get in these verbs is not the same as the nonphrasal form...
  • 17
  • 633
  • 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Báo cáo khoa học

... totally different substrate specificities, is considered for arginase and agmatinase [20] Such substrate discrimination is particularly important for mammalian arginase II and agmatinase, as both ... His145Asn variants, which were practically inactive on agmatine and markedly resistant to inhibition by the substrate analog As an example, only about 25% inhibition of the wild-type and mutant ... with a boronic acid transition state analog inhibitor was ˚ determined at 2.7 A resolution [9] Human arginases I and II are related by about 50% amino acid sequence identity and, more importantly,...
  • 9
  • 651
  • 0
Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx

Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx

Mỹ thuật

... and legal academicians The Association of Legal Writing Directors (ALWD) is a nonprofit professional association of directors and professors of legal reasoning, research, writing, analysis, and ... “CRAC” is an alternative shorthand for the “IRAC” paradigm for explaining a rule of law and its application to the facts of the case: Conclusion (rather than Issue), Rule, Application, Conclusion ... line: proportionally spaced fonts are easier to read Drs Tinker and Paterson demonstrated that American Typewriter, another monospaced font, causes a 4.7% reading delay.57 That equals almost fifteen...
  • 45
  • 646
  • 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học

... Abe A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A ... Henrissat B (1991) A classification of glycosyl hydrases based on amino acid sequence similarities Biochem J 280, 309–316 Tonozuka T, Mogi S, Shimura Y, Ibuka A, Sakai H, Matsuzawa H, Sakano Y & Ohta ... b-barrel domain (domain N), in addition to three conserved domains (domains A, B and C) in a- amylase (Fig 2) [4] Among members of GH13, several enzymes having an additional N-terminal domain have been...
  • 9
  • 342
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt

Báo cáo khoa học

... frequency and increased scoring on the BDI-21, STAI-S and STAI-T scales It should be noted that this association is not a direct one as ictal and postictal anxiety and depression have been a priori ... presented as mean ± standard deviation (SD) while non-continuous variables are given as percentages In order to assess which factors are independently associated with BDI-21, STAI-S and STAI-T, a two-step ... p-Value 0.971 0.944 0.963 The base omitted factors are SF < 1/year, SF > 1/year, CFE, IGE, AED1, AED2, AED 3, age and disease duration tions have clearly established that partial seizures, particularly...
  • 8
  • 290
  • 0
Báo cáo y học:

Báo cáo y học: " A case of spotted fever group rickettsiosis imported into the United Kingdom and treated with ciprofloxacin: a case repor" pptx

Báo cáo khoa học

... were all normal and malarial films were negative C-reactive protein was slightly raised at 29 Blood samples were collected for serological studies on initial presentation and weeks later (Table ... hospital, a left lower abdominal wall tache noire lesion was noted In addition, there were 20 small vesicular lesions on her trunk, and she had right sided painful inguinal lymphadenopathy Routine ... usually 5–7 days [2,6] but may be as long as 12 days [8] Infections can occur sporadically or in clusters [5,8] As mentioned before, the inoculation eschar is the hallmark for this condition and multiple...
  • 3
  • 347
  • 0
Insights into the mechanism of safingol and its potential to synergize with anti cancer drugs

Insights into the mechanism of safingol and its potential to synergize with anti cancer drugs

Cao đẳng - Đại học

... xii List of Abbreviations 2-NBDG 3-MA 5-FU 7AAD Abs AIF ANOVA ANT AMPK APAF-1 APP Ara-C Apo2-L Atg ATP AVO BA1 Bcl-2 BH BSA CD95 Cdk Chk CI CMA 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2deoxyglucose ... increase in cell size Senescence Mitotic Catastrophe Chromatin condensation, DNA laddering, nuclear fragmentation Partial chromatin condensation, no DNA laddering Random DNA degradation Heterochromatin ... membrane that consist of a polar phosphate head group and a pair of non-polar acyl chains connected by ester bonds to a glycerol backbone, sphingolipids are consisted of a polar amino group and a single...
  • 166
  • 459
  • 0
Tapping into the Power of Text Mining

Tapping into the Power of Text Mining

Cơ sở dữ liệu

... the analysis of patents developed to a large application area The reasons for this are on the one hand the increased number of patent applications and on the other hand the progress that had been ... information retrieval, natural language processing and information extraction In all of these areas we also apply data mining methods and statistics to handle their specific tasks: Information Retrieval ... and ultimately understandable patterns in data” The analysis of data in KDD aims at finding hidden patterns and connections in these data By data we understand a quantity of facts, which can be,...
  • 37
  • 1,334
  • 3
Báo cáo y học:

Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"

Y học thưởng thức

... margin Endochylema was vacuolated, and mitochondria swelled to a circular shape with a clear matrix and short or disappeared cristae, which were vacuolar appearances Smooth and rough endoplasmic ... Ltd Tokyo, Japan) Statistical analysis Data were expressed as means ± standard deviation (SD), and comparisons were performed with Wilcoxon rank sum test All statistical analyses were carried out ... pulse, respiration, and blood oxygen saturation were monitored during HIFU treatment Animal care The animals in Group A and B were sacrificed immediately after HIFU, and the whole pancreas was removed...
  • 7
  • 481
  • 0
Báo cáo y học:

Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"

Y học thưởng thức

... OmpA of C pneumoniae was employed The outer (oCP1 – 5’ TTACAAGCCTTGCCTGTAGG 3’, oCP2 – 5’ GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT ... detection rate in serum as compared to healthy volunteers MATERIAL AND METHODS Cell lines and bacterial strains HL cells (Washington Research Foundation, Seattle, USA) as well as C pneumoniae (strain ... Stallings TL Association of Alzheimer's disease and Chlamydophila pneumoniae J Infect 2008 Jun; 56(6):423-31 Shen D, Yuen HK, Galita DA, et al Detection of Chlamydia pneumoniae in a bilateral...
  • 10
  • 782
  • 0
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry

An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry

Thạc sĩ - Cao học

... participation in learning to speak English 21 Table 3: Teachers’ and students’ attitudes towards speaking materials and appropriate time for teaching and learning English speaking 24 Table 4: Pre-speaking ... the Teachers’ and Students’ Survey Questionnaires 20 2.3 Findings and Discussions 33 2.3.1 Teachers’ and Students’ Attitudes towards Speaking and Speaking Materials 33 2.3.2 Teachers’ and Students’ ... Practice of English Language Teaching Longman: London and New York Ellis, R (1997) Second Language Acquisition Cambridge: Cambridge University Press Le Van Canh (2004) Understanding Foreign Language...
  • 20
  • 2,397
  • 27
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

Thạc sĩ - Cao học

... better way to fly 33 Malaysia Airlines Malaysia Going beyond expectations 34 Northwest Airlines 35 Pakistan International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas The Spirit of Australia 39 ... Well-known names that can be mentioned are Air Canada, Air France, British Airways, Swissair, Lufthansa (Germany), and so on • Some other airlines which are not national airlines but really well-known ... preposition phrase, adjective phrase, etc They are so concise and to the point that they are beyond our power to any addition or subtraction Going beyond expectations - Malaysia Airlines Cathay Pacific...
  • 45
  • 1,380
  • 10

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008