0

genetic predisposition to b thalassemia and sickle cell anemia in turkey a molecular diagnostic approach

báo cáo hóa học:

báo cáo hóa học:" Hydroxyurea and sickle cell anemia: effect on quality of life" pptx

Hóa học - Dầu khí

... participated in the design and coordination of the study Samir K Ballas and Franca B Barton drafted the manuscript Franca B Barton, Myron A Waclawiw, and Michael L Terrin performed the statistical analyses ... Patients completed diaries of daily bodily pain rated on a 10-step scale with = no pain and = worst imaginable pain Mean daily pain was computed over the 28 days pretreatment a covariate for analysis ... Table B) A regression model of the effect of high HbF response on QOL adjusting for baseline values of QOL measures, HbF, annual crisis rate and mean daily pain are shown in Table The baseline...
  • 8
  • 735
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Báo cáo khoa học

... Interestingly, this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to < /b> an animal-type a- amylase (listed in Table ... Polyplacophora) and the oyster Crassostrea gigas (Mollusca, Bivalvia) Sequence data were deposited in GenBank (Table S1) Searches in databases Using the putative C-terminal domain of C fluminea as a query, ... Journal compilation ª 2011 FEBS 2335 Linkers in modular a- amylases G Feller et al Table Amino acid frequencies (%) in a- amylase linkers, in a set of globular proteins, in the Swiss-Prot databank and...
  • 8
  • 624
  • 0
Báo cáo y học:

Báo cáo y học: " Social support and antenatal depression in extended and nuclear family environments in Turkey: a cross-sectional survey" potx

Báo cáo khoa học

... the standardised assessment instruments which have been well-validated in a variety of international settings, and a comprehensive range of covariates Random sampling of antenatal clinics was not ... parental relationship prior to < /b> marriage but with lasting effects on mental health As mentioned earlier, Turkey in general (and Ankara in particular) offers important advantages for research into ... are very high in Ankara: for example, attendance for measles and BCG vaccinations 93% and 92% respectively [23] After approach, agreement and written informed consent, a brief interview was administered...
  • 10
  • 341
  • 0
Tài liệu Parental Attitude to Children with Sickle Cell Disease in Selected Health Facilities in Irepodun Local Government, Kwara State, Nigeria doc

Tài liệu Parental Attitude to Children with Sickle Cell Disease in Selected Health Facilities in Irepodun Local Government, Kwara State, Nigeria doc

Sức khỏe trẻ em

... daily lives and society’s attitudes to < /b> SCD and those affected In Africa, cultural factors are particularly relevant to < /b> these problems because of beliefs and traditional practices In Nigeria, beliefs ... genes are quite common among African ancestry (Ruiz et al 2007) In Western and Central Africa where as many as 1-2% of children have sickle cell anemia or HbSC disease, sickle cell anemia is a public ... explained that the general belief among Nigerians is that illness can be caused by natural, preternatural and mystical factors The preternatural explanation is related to < /b> the belief in witchcraft...
  • 8
  • 616
  • 0
Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx

Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx

Báo cáo khoa học

... Cas knockout cells) and CasWt cells (generated by transfecting CasKo cells with wild-type Cas) Cas expression in CasWt cells was similar to < /b> that in Balb3T3 cells, and Cas was absent in CasKo cells ... Sakai R, Suzuki T, Saito T, Nakamura K, Nakao K, Ishikawa T et al (1998) Cardiovascular anomaly, impaired actin bundling and resistance to < /b> Src-induced transformation in mice lacking p130Cas Nat ... that Src phosphorylates Cas to < /b> induce cell polarization and migration during wound healing Nck2 is crucial for cell polarization and Cdc42 activation during wound healing Crk and Nck are adaptor...
  • 12
  • 355
  • 0
human genome epidemiology 2nd edition building the evidence for using genetic information to improve health and prevent disease jan 2010

human genome epidemiology 2nd edition building the evidence for using genetic information to improve health and prevent disease jan 2010

Vật lý

... northern and western Europe USAB); (b) HapMap YRI population: Yoruba in Ibadan, Nigeria; (c) HapMap JPT population: Japanese in Tokyo, Japan, and CHB population: Han Chinese in Beijing, China 24 Principles ... Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine ... Rebbeck, Nathaniel Rothman, Jonine L Bernstein , Paul R Burton, Harry Campbell, Anand P Chokkalingam, Helena Furberg, Julian Little, Thomas R O’Brien, Daniela Seminara, Paolo Vineis, Deborah M Winn,...
  • 701
  • 498
  • 0
báo cáo hóa học:

báo cáo hóa học:" Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson''''s disease" doc

Hóa học - Dầu khí

... sigma, USA) A biotinylated secondary rabbit anti-mouse antibody (Vector Laborato- http://www.translational-medicine.com/content/7/1/53 ries, UK) and peroxidase-coupled avidin-biotin staining ... microcarriers were used to < /b> increase the survival of grafted cells [21] Indeed, microcarriers provide a substrate to < /b> which the cells can establish a basal lamina and thus create a more favorable ... Co-transplantation of carotid body and ventral mesencephalic cells as an alternative approach towards functional restoration in 6-hydroxydopamine-lesioned rats: implications for Parkinson's disease...
  • 9
  • 449
  • 0
báo cáo hóa học:

báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx

Hóa học - Dầu khí

... statistical analysis, and contributed to < /b> data discussion and manuscript preparation CF was responsible for clinical coordination and patient interaction, and contributed to < /b> data discussion and ... Pathology, National Health Laboratory Service and University of the Witwatersrand, Johannesburg, South Africa 5Department of Hematology and Molecular Medicine, National Health Laboratory Service and ... Clinical laboratory testing CD4 counts were assessed at baseline (CD4BL, last available measurement prior to < /b> ART initiation) and approximately 36 weeks from ART initiation (range 220-259 days;...
  • 9
  • 469
  • 0
Báo cáo y học:

Báo cáo y học: "DNA-like class R inhibitory oligonucleotides (INH-ODNs) preferentially block autoantigen-induced B-cell and dendritic cell activation in vitro and autoantibody production in lupus-prone MRL-Faslpr/lpr mice in vivo" potx

Báo cáo khoa học

... INH-44 CCT GAA TAA AAA CTT ACC GCT GCA B Lacks GGG INH-45 TAT GGA TGG GAA TTC CCA TCC ATA R Lacks CCT INH-46 TAT GGA TGG GAA CTT ACC GCT GCA B Lacks CCT INH-47 TAT GGA TTT TAA TTA AAA TCC ATA ... non-autoreactive B cells stimulated with linear CpG-DNA ligands In addition to < /b> autoreactive B cells, class R INH-ODNs are capable of blocking both DNA/antiDNA-induced and RNA/anti-RNA-induced IFN-α ... GGA TGG GAA B 5' linear, shortest active INH-1 CCT GGA TGG GAA TTC CCA TCC AGG R 5' palindrome INH-18 CCT GGA TGG GAA CTT ACC GCT GCA B 5' linear INH-43 CCT GGA TAA AAA TTT TTA TCC AGG R Lacks...
  • 16
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot

Báo cáo khoa học

... both HbS and normal HbA and are usually asymptomatic [1] Because of their resistance to < /b> Plasmodium falciparum, heterozygous carriers are more resistant to < /b> malaria and have a selective advantage ... typical sickle cell shape and also increases membrane fragility Dehydration due to < /b> an increased intracellular haemoglobin concentration increases HbS polymerization In homozygous sickle cell carriers, ... concentrate and normal saline (1:2) This partial exchange transfusion decreased the HbS fraction to < /b> 21.6%; afterwards, haemoglobin HPLC revealed that his HbA2 was 7.4% and HbF was 1.9% The haemoglobin...
  • 6
  • 438
  • 0
Báo cáo y học:

Báo cáo y học: " Genetic predisposition to chikungunya – a blood group study in chikungunya affected families" pot

Báo cáo khoa học

... identified Blood groups by using commercial blood group kit containing Anti -A, Anti -B and Anti-D monoclonal antibody reagents Statistical analysis was performed by using GraphPad InStat software Among ... chikungunya affected families During outbreak of chikungunya in Andhra Pradesh, India, a total of 100 chikungunya affected families from nearby villages of Sri Krishnadevaraya University, with on and average ... the final statistical analysis of the data and contributed to < /b> writing the paper VS (she is a specialist in infectious diseases) gave us guidance in selecting the chikungunya patients for research...
  • 3
  • 177
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Bench-to-bedside review: Understanding genetic predisposition to sepsis" pps

Báo cáo khoa học

... proinflammatory cytokines TNF-α, IL-1, and IL-6 and an array of other proinflammatory and anti-inflammatory cytokines The cytokines act on target cells by binding to < /b> specific cytokine receptor ... receptor-associated factor-6; IKKs, I B kinases; NF- B, nuclear factor kappa B; I B, kappa B inhibitor spliced variant of MyD88) and Tollip (Toll interacting protein) have been suggested as suppressors ... differentiation primary response 88; TIRAP, TIR domain-containing adapter protein (also known as MYD88 adaptor-like protein); TIFA, TRAF-interacting protein with a forkheadassociated domain; TRAF6,...
  • 10
  • 105
  • 0
Learn how to say things and what you think in english

Learn how to say things and what you think in english

Kỹ năng nói tiếng Anh

... well as ballet Salsa noun A type of popular music based on Latin American dance music Singers and musicians often dance at the same time as they are singing and playing Ballroom dancing is a type ... rely Bubble noun [C] a ball of air in a liquid or a delicate hollow sphere floating on top of a liquid or in the air As water begins to < /b> boil, bubbles rise ever faster to < /b> the surface Grace (BEAUTY) ... PROFESSIONAL PRACTICE AND INTERESTS: Teaching English language skills: Listening, speaking, reading and writing Teaching TOEFL, TOEIC and IELTS Teaching grammar of written and spoken English Teaching...
  • 17
  • 725
  • 5
Management of Sickle Cell Disease in Children doc

Management of Sickle Cell Disease in Children doc

Sức khỏe trẻ em

... gamma GT, ALP, bilirubin total and direct +/- amylase (if abdominal pain and clinical indications) • Arterial blood gases (if signs of respiratory failure are present) • Urinalysis (if indicated), ... developmentally appropriate pain scale q4h, and before and after each pain medication and non-pharmacologic intervention (heating pads, warm baths, other comfort measures such as imagery and distraction) ... dose) may be used as an alternative to < /b> continuous IV morphine in stable patients • If the child is comfortable and has graduated to < /b> demand dosing only, switch to < /b> oral analgesics: Acetaminophen...
  • 15
  • 388
  • 0
Báo cáo khoa học: The organotellurium compound ammonium trichloro(dioxoethylene-o,o¢)tellurate reacts with homocysteine to form homocystine and decreases homocysteine levels in hyperhomocysteinemic mice pptx

Báo cáo khoa học: The organotellurium compound ammonium trichloro(dioxoethylene-o,o¢)tellurate reacts with homocysteine to form homocystine and decreases homocysteine levels in hyperhomocysteinemic mice pptx

Báo cáo khoa học

... (pNA), was purchased from Bachem AG (Bubendorf, Switzerland) Fetal bovine serum, RPMI-1640, penicillin and streptomycin were purchased from Gibco Laboratories (Grand Island, NY, USA) Caspase-3 and ... hyperhomocysteinemia in mice can induce infertility by causing aberrant DNA structures and increased DNA fragmentation in sperm cells, as illustrated in Fig This correlates with the DNA damage caused by ... homocysteine levels are a marker for several pathologies, notably cardiovascular and neurodegenerative disorders, and several homocysteine-reducing agents, such as vitamin B6 , vitamin B1 2, and folic acid,...
  • 12
  • 360
  • 0
Báo cáo khoa học: The silencing of adenine nucleotide translocase isoform 1 induces oxidative stress and programmed cell death in ADF human glioblastoma cells doc

Báo cáo khoa học: The silencing of adenine nucleotide translocase isoform 1 induces oxidative stress and programmed cell death in ADF human glioblastoma cells doc

Báo cáo khoa học

... Lena et al CTATAGTGAGTCGTATTACC-3¢; ANT2 siRNA -a: 5¢AAGCTGGAGCTGAAAGGGAATTCTCTTGAAATTC CCTTTCAGCTCCAGCTATAGTGAGTCGTATTACC-3¢; and ANT2 siRNA -b: 5¢-AAGGATCCCAAGAACACTCA CTCTCTTGAAGTGAGTGTTCTTGGGATCCTATAGT ... 5¢-ACGTGTCTGTGCAG GGTATT-3¢; ANT2 reverse: 5¢-GTGTCAAATGGATAGG AAG-3¢; ANT3 forward: 5¢-AACCAAGAGAACCACG TAGAA-3¢; and ANT3 reverse: 5¢-CTTAGAACACGACT TGGCTC-3¢ For calibration curves, ANT1, ANT2 ... AVOs As a marker of autophagy, the appearance and volume AVOs was visualized by acridine orange staining as described previously [25] in siRNA-ANT1 -a and Scrambletransfected ADF cells The cytoplasm...
  • 15
  • 378
  • 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học

... impeding Bax oligomerization and cytochrome c release, and hence preventing cell apoptosis [61] Genetic < /b> instability due to < /b> abnormal DNA metabolism linked to < /b> impaired activity of enzymes such as topoisomerases, ... Fabunmi RP, Baker AH & Newby AC (1998) Synergistic upregulation of metalloproteinase-9 by growth factors and in ammatory cytokines: an absolute requirement for transcription factor NFkappa B ... 1253–1263 Yuan G, Nanduri J, Bhasker CR, Semenza GL & Prabhakar NR (2005) Ca2+ ⁄ calmodulin kinase-dependent activation of hypoxia inducible factor transcriptional activity in cells subjected to < /b> intermittent...
  • 12
  • 390
  • 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học

... the lack of a satiety signalling, whereas no change in food intake was detected in the B[ a] P-treated animals In addition, the absolute values of leptin in control and B[ a] P-treated animals were ... and insulin receptors The mechanisms of adrenergic receptor signalling proceed via stimulatory and inhibitory G-proteins that control adenylate cyclase activity and thus cAMP formation Insulin ... receptors share common features: all contain seven transmembrane spanning domains and are coupled to < /b> G-proteins themselves anchored to < /b> the inner leaflet of the plasma membrane In contrast ANP-induced...
  • 11
  • 424
  • 0
Learn how to say things and what you think in English

Learn how to say things and what you think in English

Anh ngữ phổ thông

... A type of popular music based on Latin American dance music Singers and musicians often dance at the same time as they are singing and playing Ballroom dancing is a type of dancing where a man ... a group or as a continuous line A woman of noble ancestry Gypsy, gipsy romany noun [C] a member of a race found in parts of Europe and America who travel from place to < /b> place in caravans Energy ... There are about fifty calories in an apple Obsessed, obsessive adjective unable to < /b> stop thinking about something; too interested in or very worried about something The government seems obsessed by...
  • 7
  • 500
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

Hóa học - Dầu khí

... clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated and participated in the design of the study, statistical analysis and ... 43:771-775 Dafallah SE, EL-Agib FH, Bushra GO: Maternal mortality in a teaching hospital in Sudan Saudi Med J 2003, 24:369-373 Laurent C, Henzel D, Mulanga-Kabeya C, Maertens G, Larouze B, Delaporte ... Leone West Afr J Med 2005, 24:18-20 Ahmed SD, Cuevas LE, Brabin BJ, Kazembe P, Broadhead R, Verhoeff FH, Hart CA: Seroprevalence of hepatitis B and C and HIV in Malawian pregnant women J Infect 1998,...
  • 3
  • 399
  • 0

Xem thêm