genes underlying a thaliana natural variation
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot
... mark, emphases the possibility that numerous other natural compounds can take the same pathways leading to apoptosis apoptosis in colorectal cancer by activation of p53 and p73 which are negative ... Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa K: Effects of valproic acid on the cell cycle and apoptosis through acetylation of histone and tubulin in a ... pancreatitis and pancreatic adenocarcinoma Gastroenterology 2005, 129:1454-1463 Unoki M, Kelly JD, Neal DE, Ponder BAJ, Nakamura Y, Hamamoto R: UHRF1 is a novel molecular marker for diagnosis and...
- 10
- 414
- 0
Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf
... Watanabe W, Yamataka K, Watanabe Y, Ohata Y, Doi S, Sato M, Kano M, Ikeda S, Matsuoka M: Broad Anti-Retroviral Activity and Resistance Profile of a Novel Human Immunodeficiency Virus Integrase Inhibitor, ... Watanabe W, Yamataka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro antiviral activity and resistance profile of a novel HIV integrase inhibitor JTK-303/GS-9137 ICAAC 2006 Low A, Mohri H, Markowitz ... inhibitors: update and perspectives Adv Pharmacol 2008, 56:199-228 Lataillade M, Chiarella J, Kozal MJ: Natural polymorphism of the HIV-1 integrase gene and mutations associated with integrase inhibitor...
- 11
- 455
- 0
Báo cáo y học: "A transcriptional network associated with natural variation in Drosophila aggressive behavior" pdf
... genetic analyses The analysis of variance (ANOVA) model Y = μ + L + ε was used to partition variation in male aggressive behavior and transcript abundance between lines (L, random) and the variation ... mean aggression score (MAS) on the y-axis Error bars are standard error In total, these analyses implicate 266 unique candidate genes associated with natural variation in aggressive behavior ... adult tissues, based on data from FlyAtlas [36] Acc Gland, accessory gland Although many of the QTTs lack annotation, we can infer potential functions based on the characterized genes that fall...
- 11
- 241
- 0
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those ... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora,...
- 4
- 403
- 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... CAAAGATGCCAAGCTG)3’ and 5’-CCCAAGCTTGA TACCGCCCAGGCAGAGGTACTTG-3’ The primers used for the PCR cloning of PA0266 were as follows: 5’-GGAATTCCATATGAGCAAGACCAACG AATCCC-3’ and 5’-CCGCTCGAGAGCGAGTTCGTCG ... PA1587 PA1591 PA1593 PA1585 PA1594 PA1592 PA1589 PA1579 PA1595 PA0265 PA0266 PA1584 PA1597 PA1599 PA1582 PA1578 PA1576 PA4330 PA1588 PA1581 PA1571 PA1570 PA0456 PA1603 PA1577 PA1573 PA1601 PA2013 ... PA2013 PA1574 PA1998 PA1596 PA1583 PA1600 PA1985 PA1604 PA1605 PA1590 PA0450 PA1629 PA0455 PA0854 PA0446 PA2556 PA2401 PA1606 PA2400 PA2250 PA1575 PA4333 PA1628 PA3416 lipoamide dehydrogenase-glc...
- 12
- 441
- 0
Báo cáo khoa học: The three typical aspartic proteinase genes of Arabidopsis thaliana are differentially expressed docx
... ATTTTGTAGGTCA and CATCTCCAGAATCACC ACCAAG; and for the AtPasp A3 gene-specific probe, the oligonucleotides were TGATGACAGCTAAAAAT GGGAACTAGG and CCATATCCGCATTTTCATC GTTCAGG To generate strand-specific ... amplification of the AtPasp A1 specific probe were (5¢fi3¢) GTTGTCAATGAATAGGTAAAATG and CAGAATCTCCAAGTCTGTAAG; for the AtPasp A2 gene-specific probe, the oligonucleotides were TGCTTTG ATTTTGTAGGTCA and ... of Arabidopsis contains three typical plant aspartic proteinase genes We are characterizing the aspartic proteinases in Arabidopsis thaliana and have isolated both the enzyme from seeds and a...
- 10
- 250
- 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... portable natural language data b a s e i n t e r f a c e Cmlf on Ap'1)lied Nc~t~ral L~znguage Processing, S a n t a Munica, Ca., 1983, pp 25-30 Biermann, A and Ballard, B Toward natural language ... Nash-Webber, Ballard, B and Tinkham, N A phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ L~n~ist~cs, to appear 24 Ginsparg, J A robust portable ... Waltz, D An English language question answering system for a large relational database Cowzm A C M 21 (1978), 7, pp 526-539 22 Woods, W Semantics and quantification in natural language question answering...
- 5
- 452
- 0
Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx
... nodes Martin et al [12] define a transportable NL interface as one that can acquire a new domain model by interacting with a human database expert Although DATALOG does not yet have such a capability, ... model to handle more complex databases, and integrating a pragmatic component for handling anaphora and other dialogue-level phenomena into the Cascaded ATN grammar References 10 Bates, M and Bobrow, ... Laboratories, Warren MI (1984) Grosz, B J., "TEAM: A Transportable Natural Language Interface System." In Proc Conf on Applied Natural Language Processing, Santa Monica CA, pp 39-45 (1983) Hafner, C D and...
- 4
- 253
- 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt
... sentence is a potential garden path in a psych~ logically plausible way The semantic knowledge plays a fundamental role in choosing a particular analysis Milne argues that a one-word lookahead, with ... in Natural Language Understanding Systems AJCL (1981), 99-108 Lesmo L., Magnani D., Torasso P.: A Deterministic Analyzer for the Interpretation of Natural Lan guage Commands Proc.7th IJCAI, Vancouver ... IJCAI,Vancouver(1981), 432-439 Kaplan S.J (ed.): Special Issue on Natural Lan guage Processing, SlGART Newsletter 79 (1982) Konolige K.G.: A Framework for a Portable Natural Language Interface...
- 8
- 412
- 0
Báo cáo khoa học: "Integrating Discourse Markers into a Pipelined Natural Language Generation Architecture" potx
... regularities and alternatives In Second International Natural Language Generation Conference, pages 105–112, Harriman, NY, July M Kantrowitz and J Bates 1992 Integrated natural language generation ... International Workshop on Natural Language Generation, pages 138–147, Niagara-on-the-Lake, Canada Manfred Stede and Carla Umbach 1998 DiM-Lex: A lexicon of discourse markers for text generation and ... Intensive Natural Language Generation with Revision Ph.D thesis, Virginia Polytechnic and State University, Blacksburg, Virginia Hercules Dalianis and Eduard Hovy 1993 Aggregation in natural language...
- 8
- 208
- 0
Báo cáo hóa học: " Mixed convective boundary layer flow over a vertical wedge embedded in a porous medium saturated with a nanofluid: Natural Convection Dominated Regime" pdf
... factor and surface mass transfer rates increase, whereas the surface heat transfer rate decreases As Le increases, the heat transfer rate decreases, whereas the mass transfer rate increases As ... heat transfer rate, and mass transfer rate have been presented for parametric variations of the buoyancy ratio parameter Nr, Brownian motion parameter Nb, thermophoresis parameter Nt, and Lewis ... Madina Al Munawara, Saudi Arabia Department of Mathematics, South Valley University, Faculty of science, Aswan, Egypt Authors’ contributions RSRG conceived of the research and formulated the analysis,...
- 9
- 294
- 0
Báo cáo hóa học: " Research Article Existence of Solutions and Convergence of a Multistep Iterative Algorithm for a System of Variational Inclusions with (H,η)-Accretive Operators" pot
... nonlinear variational inequalities As generalizations of the above systems of variational inequalities, Agarwal et al [33] introduced a system of generalized nonlinear mixed quasivariational inclusions ... Kassay and Kolumb´ n [17] introduced a system of variational inequala ities and proved an existence theorem by the Ky Fan lemma Kassay et al [18] studied Minty and Stampacchia variational inequality ... of Inequalities and Applications [11] S Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applications,...
- 20
- 366
- 0
Báo cáo hóa học: "CONVERGENCE AND STABILITY OF A THREE-STEP ITERATIVE ALGORITHM FOR A GENERAL QUASI-VARIATIONAL INEQUALITY PROBLEM" doc
... one can obtain from GQVIP (2.10) a number of known and new classes of variational and quasi-variational inequalities as special cases in the literature 6 A general quasi-variational inequality ... Siddiqi and Q H Ansari, An algorithm for a class of quasivariational inequalities, Journal of Mathematical Analysis and Applications 145 (1990), no 2, 413–418 R U Verma, The solvability of a class ... of Mathe[20] matical Analysis and Applications 228 (1998), no 1, 206–220 16 A general quasi-variational inequality problem [21] , New approximation schemes for general variational inequalities,...
- 16
- 259
- 0
Báo cáo hóa học: " ON THE STUDY OF A CLASS OF VARIATIONAL INEQUALITIES VIA LERAY-SCHAUDER DEGREE" pot
... Publishers, Massachusetts, 2003 D Goeleven, D Motreanu, Y Dumont, and M Rochdi, Variational and Hemivariational Inequalities: Theory, Methods and Applications Vol I Unilateral Analysis and Unilateral Mechanics, ... Goeleven and D Motreanu, Variational and Hemivariational Inequalities: Theory, Methods and Applications Vol II Unilateral Problems, Nonconvex Optimization and Its Applications, vol 70, Kluwer Academic ... Springer-Verlag, Berlin, 1992 D Kinderlehrer and G Stampacchia, An Introduction to Variational Inequalities and Their Applications, Classics in Applied Mathematics, vol 31, Society for Industrial and Applied...
- 11
- 310
- 0
Báo cáo y học: " Towards a comprehensive structural variation map of an individual human genome" pot
... single approach that can readily capture all types of variation and that a combination of strategies is required The data also show that structural variation impact many genes that have been linked ... comparison with various data sets Additional file Affymetrix 6.0 variants and comparison with various data sets Additional file Illumina M variants and comparison with various data sets Additional ... Additional file Split-read variants and comparison with various data sets Additional file Agilent 24 M variants and comparison with various data sets Additional file NimbleGen 42 M variants and...
- 14
- 295
- 0
báo cáo khoa học: "Conditional probabilities of identity of genes at a locus linked to a marker" potx
... data, validation of pedigrees from polymorphism analysis, and detection of associations between a marker locus and linked genes contributing to a quantitative character measures II Conditional ... investigation of a marker locus Behav Genet., 2, 3-19 linkage between a quantitative trait and S.D., 1970 On the detection and estimation of linkage between a locus influencing a character and a marker ... detection are based on an analysis of variance aimed at out the significance of effects attached to the identity states of genes linked to the marker locus In the case of a population of half sibs...
- 13
- 173
- 0
báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx
... essential for survival of Arabidopsis FEBS Letters 2004, 556:148-152 39 Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi ... absorption at 254 nm External standards were made using the Waters physiological amino acid standard with addition of Asn, Gln, GABA and Trp (Sigma) This standard was diluted to make a standard curve ... SYNTHETASE1 and PROLINE DEHYDROGENASE2 Plant J 2008, 53:935-949 Gupta V, Raghuvanshi S, Guptya A, Saini N, Gaur A, Khan MS, Gupta RS, Singh J, Duttamajumder SK, Srivastava S, Suman A, Khurana JP, bKapur...
- 14
- 573
- 0
báo cáo khoa học: " Isolation and functional characterization of cold-regulated promoters, by digitally identifying peach fruit cold-induced genes from a large EST dataset" pptx
... gAgTTggATgggTCCTCTgC CCAAACCAAAgCCAgTTTCATTCA CCAggTTTTgTATgAgTgCCgTA ACCTTggCCATCCTCTTCTT AgAAATCTTgACCCCCgTTC AAggAgCTCTTgACgTTggA TgCTAACAggTgggAAAACC CCTTCCAgCAgATgTggATT AgATTAggCAAggCgAggAT ... ACTCATCAgTCTTAgTAggCTCgggTgTT TgATTTTAgCTgCATgTgCACCTgAgAA CgTCATggAAATgTCTTAATTggCTTgCTg gAAgAAAACAAATTgggAggAggAgAA gCgTgTTCCAAAgAACACAATTCAgTgCCTT BEC-32BamHI DX24BamHI ggATCCTgATCTgTggATTgggTTTCgTgg ... AgATTAggCAAggCgAggAT BEC87-GSP1 BEC55-GSP2 DX85-GSP1 DX46-GSP2 THA82-GSP1 THA-1-GSP2 LOX101-GSP1 LOX63-GSP2 TgCATTTCCAgCTTgCCTCCCACATTg CTgAgATCCCTAACAgCAAAgCTAgggATA ACCggTTCCggTggTggTgTgATgAACC ACTCATCAgTCTTAgTAggCTCgggTgTT...
- 15
- 345
- 0
Báo cáo y học: "RNA polymerase II stalling: loading at the start prepares genes for a sprint" pot
... BM: A new paradigm in eukaryotic biology: HIV Tat and the control of transcriptional elongation PLoS Biol 2005, 3:e76 Aida M, Chen Y, Nakajima K, Yamaguchi Y, Wada T, Handa H: Transcriptional pausing ... H3K9ac and K14ac are associated with Pol II promoter-proximal binding [16] How Pol II stalling is regulated also remains to be investigated As noted above, data from Hsp70 indicate that stalling ... binding signals are also observed at the 3’ ends of transcripts It is possible that Pol II also pauses upon termination of transcription (Z Lian, A Karpikov, J Lian, MC Mahajan, S Hartman, M Gerstein,...
- 6
- 242
- 0
Báo cáo y học: "Contribution of transcriptional regulation to natural variations in Arabidopsis" ppsx
... 5'-TGTATGACCCGGATGCTTCA3' 14072_at_reverse primer: 5'-ACGCAAGAACCAGAGAGTTTGAT-3' 14072_at_target probe: FAM-CAGGCACACAGTGGAAAACGTCTGA-TAMRA 13111_at_forward primer: 5'-GAGATCAAGAGCATGGTGGAGTT-3' ... 5'-primer: 5'-CAGTTTCTCAAGTTGCTAAG-3'; 3'-primer: 5'-CATTCC-TTGAGACAATCCAT-3' 14097_at_forward primer: 5'-CAACAAAGGAAAACGCGATCA-3' 14097_at_reverse primer: 5'CGCTACCGTCAGAGACTTGAGA-3' 14097_at_target ... FAMCGTCGCCGGTGTCGGTG-TAMRA 16892_at_forward primer: 5'-CCGGTTAATGATGAGCAAGCA-3' 16892_at_reverse primer: 5'-CCTCCTTCAATTCCAACGCTAA-3' 16892_at_target probe: FAMATGAAGGCAGTGGCACACCAACC-TAMRA 17860_at_forward primer:...
- 25
- 463
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25