genes environments and interactions
ESSAYS ON RISK AND SOCIAL PREFERENCES EVIDENCE FROM GENES, CULTURE, AND STRATEGIC INTERACTIONS
... as alterative hypotheses and among the most important and influential is prospect theory (PT) Kahneman and Tversky (Daniel Kahneman and Amos Tversky, 1979, Amos Tversky and Daniel Kahneman, 1992) ... Neuroimaging and Behavioral Study of Human Decision Making”) and National University of Singapore (“Decision Making Under Urbanization: A Neurobiological and Experimental Economics Approach” and Start-Up ... dopaminergic (A Dreber and C L Apicella, 2009, C Frydman et al., 2011, C M Kuhnen and J Y Chiao, 2009) and serotonergic (L G Crisan et al., 2009, K Doya, 2008, C M Kuhnen and J Y Chiao, 2009, C...
- 139
- 375
- 0
Tài liệu Grid Computing: Software Environments and Tools docx
... Korea and Thailand), the European Union (as part of the Framework and programmes, and national activities such as the UK eScience programme), and the US (as part of the NSF CyberInfrastructure and ... User interfaces, applications and PSEs Programming and development models, tools and environments Middleware, services and resource management Heterogeneous resources and infrastructure However, ... program transformation and refinement, simulation and code generation, configuration and deployment, and the coordination and control of distributed execution New abstractions, models and tools are required...
- 358
- 389
- 0
Tài liệu The future impact of the Internet on higher education: Experts expect more-efficient collaborative environments and new grading schemes; they worry about massive online courses, the shift away from on-campus life docx
... advisers, and friends working to identify, explore, and engage with the challenges and opportunities of evolving communications forms and issues They investigate the tangible and potential pros and ... potential of new technologies and the pace of the demand I think one-year advanced degrees and certifications should be developed; more online and group learning and more leadership in general ... willing and able to effectively market themselves) will become ‘superstars,’ in demand for various sorts of lectures and workshops, both live and recorded, at their own institutions and at other...
- 43
- 585
- 0
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used ... CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...
- 13
- 439
- 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... 5¢-CTCGAGCCACCCAATTTCGGAAAGT Table Over-expression plasmids for Sno1p and Snz1p prepared in this study Symbols O, Z and H stand for Sno1p, Snz1p and His-tag, respectively Primer Name of plasmid Forward Backward ... pyridoxine and leucine The plasmids were isolated from S cerevisiae as described [14] Construction of over-expression plasmids for the SNO1 and SNZ1 genes The coding regions of the SNO1 (672 bp) and ... found that 4.6 and 5.1 kb overlapping fragments of chromosome XIII carrying SNO1 and SNZ1 were capable of complementing the defect of mutant K64 (Figs and 2) They are homologues of PDX2 and PDX1 of...
- 8
- 649
- 0
Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot
... is bound to both LMO2 and HGAL promoters and thus can directly act to suppress these genes PRDM1 directly regulates the HGAL and LMO2 promoters PRDM1 regulates its target genes at the level of ... important to define the role of PRDM1 inhibition of HGAL and LMO2 in the pathogenesis and outcome of DLBCL Materials and methods Cell lines and protein accession numbers Human non-Hodgkin lymphoma ... B-cell phenotype and in maintaining cellular proliferation, for example, CIITA, PAX5, Spi-B, Id3 and c-myc [42–46] In addition, we have recently identified the proliferation genes PCNA and MKI67 as...
- 11
- 343
- 0
Báo cáo khoa học: Binding affinities and interactions among different heat shock element types and heat shock factors in rice (Oryza sativa L.) ppt
... 695 genes G-type and 1584 genes S-type HSEs in the rice genome (Fig 1A) In total 711, 476 and 1368 genes contained exclusively the P-, G- and S-type HSEs, respectively; 59 genes showed both P- and ... and G-type HSEs, 56 genes a combination of P- and S-type HSEs, while G- and S-type HSEs were noted together in 33 genes Also, 127 genes showed all three types of HSEs (P, G and S) in their promoter ... of 67 393 genes, 2830 genes contain at least one of the three HSE-type configurations in their 1-kb upstream promoter region Overall, 953 genes contain P-type, 695 genes G-type and 1584 genes S-type...
- 10
- 539
- 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): molecular structure and interactions with HGFA inhibitor-1 (HAI-1) doc
... ‘open’ (standard conformation; PDB 1YC0) and ‘closed’ (nonstandard conformation; PDB 1YBW) HGFA forms are superimposed, with the two different 220-loop conformations shown in cyan and magenta, ... native HGFA and chymotrypsinogen residue numbers, see [4]), and we employ the nomenclature of Schechter and Berger [5] in describing specific sites of protease–substrate (or inhibitor) interactions ... is supported by new hydrogen bonds and hydrophobic interactions involving Trp215, also including some interactions from a crystal packing contact This nonstandard 220-loop arrangement is not...
- 8
- 298
- 0
Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt
... oligonucleotides FRBGL1 and FRBGL2 or FRBGL1 and FRBGL3, based on the conserved sequences of dtxR homologous genes [1], and the DNA of S coelicolor as template PCR products of 313 bp and 451 bp were ... After digestion of the cosmids with ApaI, KpnI and PstI, an ApaI band of 4.0 kb from cosmid 10A7, a 1.0 kb ApaI band from cosmid D10 and an 8.0 kb PstI band from cosmid D52 gave a strong positive ... cosmids D10 (A) and ⁄ 10A7 (B) containing the dmdR1 and dmdR2 genes The arrows indicate the location of the ORFs and the orientation in each DNA fragment The ApaI fragments of cosmids D10 and ⁄ 10A7,...
- 11
- 315
- 0
Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc
... CRABPIa (88%) and the mammalian and pufferfish CRABPIs (84–85%) (Fig 1A), lower sequence identity to the mammalian and fish CRABPIIs (58–71%) and lowest identity to the mammalian and fish CRBPs ... Another pair of duplicated genes (foxb1.1 and foxb1.2) on zebrafish LG and LG 25 and the human FOXB1 ortholog on chromosome 15 are underlined The order of the human syntenic genes on human chromosome ... optic tectum RA and docosahexanoic acid, the ligands for CRABPI and B-FABP, respectively, are necessary FEBS Journal 272 (2005) 3561–3571 ª 2005 FEBS for neurogenesis As such, crabp1a and fabp7a may...
- 11
- 312
- 0
Báo cáo khoa học: Structure, location and interactions of G-quadruplexes pdf
... antiparallel (with two strands running in each direction and either lateral or diagonal loops) [13] or a mixed ‘3 + 1’ hybrid, with three strands in one direction and one in the other, and a mixture of ... the guanines in a plane, p–p interactions between the guanines in adjacent planes and charge–charge interactions between the partially negative O6 of the guanines and cations that typically sit ... only a single-strand folding and say little about the effects of having the complementary strand present Experiments that have been done show that, as expected, the complementary strand tends to...
- 7
- 394
- 0
individuals and interactions elektronisk ressurs an agile guide
... individuals and xv xvi Individuals and Interactions interactions focus more on psychology and human behavior It is less black and white and less perfect Arguably the most common and most complex ... profile Understanding and Accepting Others Individuals that understand DISC can perform better on teams by understanding and accepting other team member’s behaviors 17 18 Chapter Behavior and Individuals ... boards, and the list goes on and on At a high level, the majority of these are either processes or tools Yet the Agile Manifesto espouses individuals and interactions over processes and tools...
- 218
- 343
- 0
Genes, drugs and food doc
... genetic features of common diseases such as heart disease and diabetes and the way external factors such as diet and smoking interact with our genes to increase the likelihood of developing a given ... Genes, drugs and food Ruth Chadwick Director, CESAGen Lancaster University Outline • New technologies have led to revisiting of the individual-collective relation in public health • and ... make healthy choices It sets out how health can be supported and improved in key environments such as retail outlets, local communities and the workplace Public engagement • 2003 – traces of deficit...
- 35
- 136
- 0
ASPECTS OF PACEMAKERS – FUNCTIONS AND INTERACTIONS IN CARDIAC AND NON-CARDIAC INDICATIONS ppt
... – Functions and Interactions in Cardiac and Non-Cardiac Indications, Edited by Oliver Vonend and Siegfried Eckert p cm ISBN 978-953-307-616-4 free online editions of InTech Books and Journals ... pacemakers and the exploration of their controllability lead to a remarkable progress in human medicine On cellular basis proliferation and orientation are regulated, and contraction and organ interactions ... Aspects of Pacemakers – Functions and Interactions in Cardiac and Non-Cardiac Indications References [1] Lopez, A.D., et al., Global and regional burden of disease and risk factors, 2001: systematic...
- 206
- 309
- 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt
... methods and performed the experiments Both wrote the Materials and methods section RR and GH took care of all patients They collected clinical data and all blood samples and radiographs and scored ... determination of the concentration of MMP1 and MMP3 and stored at –80°C (see below) Genotyping MMP1 and MMP3 promoter polymorphisms were determined by single-strand conformation polymorphism analysis ... the genes MMP3 and MMP1 shows an association with severe RA was tested with a likelihood ratio test, which tested the frequencies of allele differences and of a given haplotype in severe and...
- 9
- 357
- 0
báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
... receptor genes and their products in ALL survivors Therefore, the aim of our study was to determine the polymorphisms of leptin and leptin receptor genes and plasma levels of leptin and leptin soluble ... correlation of the polymorphism of the leptin gene - 18G > A and the leptin receptor genes K109R and Q223R, and overweight status at ALL diagnosis and after ALL treatment was found No statistically significant ... receptor genes with overweight and the intensity of chemotherapy and/ or CRT We have not identified any oher studies revealing the influence of the polymorphisms of both leptin and leptin receptor genes...
- 9
- 356
- 0
Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx
... 260 genes were commonly increased and 337 genes were decreased in Among the differentially expressed genes, we chose to focus on two candidate genes encoding transcription factors: NCoA3 and ... ratio > for increased genes and < -1 for decreased genes e Change p-value < 0.0001 for significant increased genes and 1-change p-value > 0.9999 for significant decreased genes b Signal (U1NaBvsU1 ... ratio > for increased genes and < -1 for decreased genes e Change p-value < 0.0001 for significant increased genes and 1-change p-value > 0.9999 for significant decreased genes b Signal sion is...
- 14
- 315
- 0
Báo cáo y học: "Upregulation of the pro-apoptotic genes BID and FAS in septic shock patients" pps
... du Grand Revoyet, 69495 Pierre-Bénite, France Page of 10 Authors’ contributions FT-D and FV conceived the study, participated in its design and data analysis, and drafted the manuscript FV and ... cytometric methodology, and participated in data acquisition and analysis AL was involved in clinical sample and data acquisition FT-D established the PCR methodology and the analysis, and designed the ... patients with septic shock (six women and seven men) and 15 healthy volunteers (sex-matched and age-matched) were enrolled in the present study The demographic and clinical characteristics of the...
- 10
- 354
- 0
Báo cáo y học: "Gene expression atlas of the mouse central nervous system: impact and interactions of age, energy intake and gender" pdf
... chromosomes 4, 5, 6, 11 and 15, and of downregulated genes on chromosomes 5, and 11 Clusters of CRresponsive upregulated genes were present on chromosomes 5, 6, and 9, and of downregulated genes on chromosomes ... therefore generated and analyzed maps of the chromosome locations of genes that were significantly affected by age, diet and gender Age-responsive genes and CR-responsive genes were scattered ... than 600 genes affected The cortex and hippocampus were next in line (more than 400 genes) , followed by the cerebellum and striatum with less than 200 genes each The percentage of all genes that...
- 17
- 358
- 0
bowlin et al - 2014 - the effects of auditor rotation, professional skepticism, and interactions with managers on audit quality
... Mishra, and Raghunandan (2008), and Davis, Soo, and Trompeter (2009) find positive effects Ghosh and Moon (2005), Knechel and Vanstraelen (2007), Chen et al (2008), Chi, Huang, Liao, and Xie ... (2004), Ghosh and Moon (2005), Chen, Lin, and Lin (2008), Gul et al (2009), and Rice and Weber (2012) find negative effects of rotation on audit quality Carey and Simnett (2006), Kealy, Yee, and Stein ... regulatory, and business implications for auditors, and is an important component of audit quality (e.g., Kadous 2000, 2001; King 2002, 268; and Peecher and Piercey 2008) Auditing standards (e.g., mandatory...
- 51
- 681
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25