... as an extracytoplasmic thioester acyl–enzyme intermediate Biochemistry 49, 341–346 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine ... Depletion of apolipoprotein N-acyltransferase causes mislocalization of outer membrane lipoproteins in Escherichia coli J Biol Chem 280, 974–983 32 Kodama K, Fukuzawa S, Nakayama H, Kigawa T, Sakamoto ... sequence of the Gram-positive bacterium Bacillus subtilis Nature 390, 249–256 Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T et al (2002) Genome and virulence...
... 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse) The pET151 HP1287 plasmid was amplified using PfuTurbo DNA polymerase and incubated with DpnI to digest the template plasmid Mutated ... QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
... Vannoni et al Formation of ADP from AMPA B Fig Backbone superimposition of human (blue) and rat (magenta) AdK The natural ligands (ADA and ATP, blue) and the two AMP molecules (magenta) are shown ... the activities of AdK, MK, ADA and AMPAMP phosphotransferase in normal and cancerous human colorectal mucosa The MK activity did not vary, but the AdK and ADA activities were significantly elevated ... activity was restored every time we combined the two separate protein preparations ADA was also isolated When ADA was added to the assay mixture, AMPAMP phosphotransferase activity was greatly...
... Th1/Th2 paradigm Scand J Immunol 1998, 47:1-9 Romagnani S: Th1 and Th2 in human diseases Clin Immunol Immunopathol 1996, 80:225-235 Bermejo-Martin JF, Garcia-Arevalo MC, Alonso A, De Lejarazu RO, ... A, Bernardo D, Leon AJ, Garrote JA, Ardura J, Dominguez-Gil M, Eiros JM, Blanco-Quiros A, Munoz-Fernandez MA, Kelvin DJ, Arranz E: Persistence of proinflammatory response after severe respiratory ... Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM, Chau NV, Khanh TH, Dong VC, Qui PT, Cam BV, Ha Q, Guan Y, Peiris JS, Chinh NT, Hien TT, Farrar J: Fatal outcome of human influenza A (H5N1) is associated...
... Proof: δ(t1 )[av1 at1 ar1 as1 au1 |av2 at2 ar2 as2 au2 ] = t1 {∂([av1 at1 ar1 as1 au1 |av2 at2 ar2 as2 au2 ])} = 5 5 29 v t1 {[av2 at2 ar2 as2 au2 ] − [a5 1 +v2 +r2 s1 at1 +t2 +u1 s2 ar1 +r2 as1 ... cohomology ofa finite group is isomorphic to the cohomology of the classifying space of the group So, a typical example of the ideas that follow familiar to the reader may be the case ofa topological ... cohomology ofa group Generally, a spectral sequence is a sequence of objects called pages that ”converges” to the cohomology of the group G A page in a spectral sequence is a st quadrant array of modules...
... takes a critical "leap of faith" on the part of the auditor/security professional: that the organization does indeed maintain an e−mail log/file and also archives all e−mail traffic Additionally, ... disk cache to see if the data is there Disk caching can dramatically improve the performance of applications because accessing a byte of data in RAM can be thousands of times faster than accessing ... participates in the St Louis InfraGard chapter John W Rado is a geospatial analyst at National Imagery and Mapping Agency (NIMA) in St Louis, Missouri John has worked for NIMA since January of...
... molecular mass calibration markers included thyroglobulin (670 kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), conalbumin (78 kDa), albumin (66 kDa), and b-lactoglobulin ... This strain, as expected, was respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found ... oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14] A higher-order organization of the respiratory chain...
... CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG GATTTAAGTGGAGCGGAATGCTA A1 F A1 R B13R ... forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ... of each mRNAldh a isoform per ng total RNA at each acclimation temperature was quantified (Table 3) At AT ¼ 18 °C the ratio between b mRNAa ldh a and mRNAldh a is almost : However, at AT ¼ °C the...
... Walborg EF Jr (1983) Characterization ofa family of glycoproteins associated with the bile canalicular membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular ... Pozzi N, Tamasi S & Pignata C (1998) Occupancy of dipeptidyl peptidase IV activates an associated tyrosine kinase and triggers an apoptotic signal in human hepatocarcinoma cells Hepatology 27, ... Kameoka J, Tanaka T, Nojima Y, Schlossman SF & Morimoto C (1993) Direct association of adenosine deaminase with a T cell activation antigen, CD26 Science 261, 466–469 Girardi AC, Degray BC, Nagy...
... 4-methoxyacetophenone (III), and a- keto diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, ... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett ... characterization, and catalytic properties ofa unique H2O2-requiring oxygenase Proc Natl Acad Sci USA 81, 2280–2284 Glenn, J.K & Gold, M.H (1985) Purification and characterization of an extracellular...
... cluster of S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C ... complementation assays The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods), ... in A2 0 1A biosynthesis In contrast, upstream of ard1 there are six contiguous coding sequences with identical orientation (Figs and 3A) Of these, five (ataP3, ataP5, ataP4, ataP10 and ataP7) are...
... effects of the latter variable across small firm-years making a low use of trade credit; small firm- years making a high use of trade credit; large firmyears making a low use of trade credit; and large ... firm-years rather than simply firms See Carpenter and Guariglia (2003), Bond and Meghir (1994), Kaplan and Zingales (1997), Guariglia and Schiantarelli (1998), and Guariglia (2000) for a similar approach ... channel actually weakens the traditional credit channel (see De Blasio, 2003, for a similar approach) As financially constrained firm- years are more likely to be affected by financial variables...
... the actual constraints exerted by the structure ofa balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors Section two of the paper ... identification of financial constraints as an impediment to an increase in output It then graphically appears that a high probability of profit is associated with good performances along both axes ... of wage arrears However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased their headcount, most often marginally but in many cases by substantial...
... acquiring and acquired banks before the merger In all cases, the efficiency rank is calculated relative to the peer group of all large banks that had data available over exactly the same time period as ... management structure Alternatively, acquisition ofa relative small bank also has potential advantages, such as an easier integration of computer and accounting systems and fewer internal struggles for ... variables are statistically significant in the AROAa equation, eliminating the significance of the STINCOME variable (which was the only significant variable in the equation in Table 3), and almost...
... of chorismate synthase caused a substantial decrease in activity beyond the detection limit of our assay In contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) the Ser16AlaSer127Ala ... reaction is characterized by the occurrence ofa transient species 1468 Table Chorismate synthase activity of the serine mutant proteins (Ser16Ala, Ser127Ala and Ser16AlaSer127Ala) in comparison ... character of the chorismate synthase reaction Experimental procedures Reagents All chemicals were of the highest grade available and obtained from Sigma or Fluka (Buchs, Switzerland) DEAE Sephacel...
... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... method of the PAUP package The percentage recovery of the branch in 1000 bootstrap replications is indicated ActR2b Carassius auratus (ABB58749)Daf-1 Caenohabditis elegans (P20792), Daf-4 Caenohabditis...
... deviation of the average return of assets, E stands for equity, and A for total assets.22 The latter two are used to calculate the capital assets ratio (E /A = CAR) ROAA and CAR are both averages ... federal state bank is a liated with a state (“Bundesland”) or group of states The a liated savings banks own each a part of their federal state bank The federal state banks act as regional clearing ... Dummy variable for removal of government guarantees (after removal of state guarantees) Aggregated total assets of groups of savings banks Downgrade of federal state bank in numerical rating notches...
... Rwanda, Senegal, South Africa, Sri Lanka, Tanzania, Togo, Uganda, Vietnam, Zambia and Zimbabwe – and mainly over cereals—maize, wheat, sorghum, millet and teff (see Tables and 3) Table Dataset ... DR Congo, El Salvador, Ethiopia, Ghana, Ghana, Guatemala, Honduras, India, Indonesia, Kazakhstan, Kenya, Malawi, Mexico, Morocco, Mozambique, Nepal, Niger, Nigeria, Pakistan, Paraguay, Peru, Philippines, ... Land Management Practices for Climate Change Mitigation and Adaptation in Sub-Saharan Africa Rome, Food and Agriculture Organization of the United Nations World-Bank 2006 Sustainable Land Management:...