generation of tandem chromosomal duplication with a lac transcriptional fusion muda or a lacz translational fusion mudb to the gene of interest at the duplication join point

Báo cáo khoa học: " Pharmacokinetics and dosage regimen of ceftriaxone in E. coli lipopolysaccharide induced fever in buffalo calves" pot

Báo cáo khoa học: " Pharmacokinetics and dosage regimen of ceftriaxone in E. coli lipopolysaccharide induced fever in buffalo calves" pot

Ngày tải lên : 07/08/2014, 18:21
... Van Miert ASJPAM Fever and associate clinical haematologic and blood biochemical changes in the goat and other animal species Vet Q 1985, 7, 200-216 23 Van Miert ASJPAM Fever, anorexia and forestomach ... regression The data gave best fit to the threecompartment model Akaike information criterion (AIC) and MAICE (minimum Akaike information criterion) values were applied to select the model The data were ... conducted a detailed pharmacokinetic study Thus appropriate dosage schedule of ceftriaxone on the basis of pharmacokinetic data was calculated for buffalo in febrile conditions With a minimum therapeutic...
  • 4
  • 291
  • 0
Báo cáo khoa học: " Efficacy of VP2 protein expressed in E. coli for protection against highly virulent infectious bursal disease virus" pot

Báo cáo khoa học: " Efficacy of VP2 protein expressed in E. coli for protection against highly virulent infectious bursal disease virus" pot

Ngày tải lên : 07/08/2014, 18:21
... )2PV( negitna evitcetorp -tsoh tnanibmocer fo noitaziretcarahc lacigolonummi dna lacimehcocisyhP JK yehaF ,WC draW ,A nampahC ,GH enieH ,P alliaF ,GI eidaercaM ,MN nreKcM ,AA dazA 891-091 ,941 ... ezis etamixorppa eht htiw detceted saw nietorp 2PV fo dnab nietorp detcepxe na sisylana tolb nretseW eht no desaB nietorp desserpxe latot eht fo %8.3 tuoba detutitsnoc nietorp 2PV eht taht detamitse ... noitaniccav detaidem-AND hguorht suriv esaesid lasrub suoitcefni tsniaga noitcetorp laitraP HC oremoR ,JD esluH 31 083-963 ,03 ,1002 lohtaP naivA noiger elbairavrepyh 2PV eht fo noitaziretcarahc ralucelom...
  • 7
  • 520
  • 0
Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt

Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt

Ngày tải lên : 12/08/2014, 04:21
... communis as template since lectins not contain introns The forward (5' CCG CAT GAA TTC ATG GCT GAT GTT TGT ATG GAT CCT GAG CCC ATA 3') and reverse primers (5' ACC TGC CTA TCA CTC GAG AAA TAA TGG TAA ... Western Ontario), using a forward (5' GTC GAC CCT ATA GTG CAG AAC 3') and reverse primers (5' AAG CTT TCT AGA TTA TTA CAA AAC TCT TGC TTT ATG 3'), incorporating SalI, HindIII and XbaI sites After ... leading to the hypothesis that this lectin represents a novel adjuvant-carrier On the other hand, the lack of an optimal adjuvant and carrier to enhance antiviral responses has been problematic...
  • 11
  • 292
  • 0
Tài liệu Khảo sát sự ô nhiễm Coliforms, E.coli, S.aureus trong kem, sữa tươi, bánh ngọt tại cửa hàng bán lẻ trên quận 4 của Hà Nội docx

Tài liệu Khảo sát sự ô nhiễm Coliforms, E.coli, S.aureus trong kem, sữa tươi, bánh ngọt tại cửa hàng bán lẻ trên quận 4 của Hà Nội docx

Ngày tải lên : 19/02/2014, 10:20
... Phùng S a 96 C a Bắc S a 96 C a Bắc S a 28 Phan Đình Phùng S a 28 Phan Đình Phùng Bánh Gato26 Phan ĐìnhPhùng Gato26 Phan ĐìnhPhùng Gato Đội Cấn Gato Đội Cấn Gato 29 Cát Linh Gato 29 Cát Linh Gato28 ... Phóng Gato Hàng Chuối Gato Hàng Chuối Gato 175 Lò Đúc Gato 175 Lò Đúc Gato 238 Trần KhátChân Gato 238 Trần KhátChân Gato 156ALò Đúc Gato 156ALò Đúc Cách Kết Kiểm tra Coliforms E coli S aureus ... (Mc) S a 31 Đào Tấn (Mc) SữaphốNhânchính(Bvì) S a Nhân (Bvì) Bánh Gato 164 Đờng Gato 164 Đờng Gato cắt Pháo đài láng Gato cắt Pháo đài láng Gato PCK ngh a đô Gato PCK ngh a đô Gato phố Nhân Gato...
  • 32
  • 997
  • 1
Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf

Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf

Ngày tải lên : 29/03/2014, 09:20
... cuagcuaauaaauuaAGGAGGauuuaaauAUGAGUGAAUCACAAGCCc cuagcuaauaaauuaAGGAGGauuuaaauAUGAAAAAGGAGUCGACUc cuagcuaauaaauuaAGGAGGauuuaaauAUGACCGAGGGUGUUUCCc FEBS Journal 277 (2010) 2428–2439 ª 2010 The Authors Journal compilation ... ksg/MG1655 pSS101 3A TIR cuagcuaauaaauuaAGGAGGauuuaaauAUGaaaccucuagagucgacu 2A TIR cggauaacaauuucacacAGGAaacagaccAUGgaauugcaacacgauaag Fig Protein expression from the pSS101 plasmid as measured by ... pooled together, and the isotope ratios for the total cellular proteins, as well as the 3A and 2A protein bands in PAGE gels, were calculated The isotope ratios for the 3A reporter gene and the...
  • 12
  • 484
  • 0
a course in universal algebra - s. burris and h.p. sankappanavar

a course in universal algebra - s. burris and h.p. sankappanavar

Ngày tải lên : 31/03/2014, 14:57
... rise to algebraic lattices of closed subsets are called algebraic closure operators; actually the consequence operator of Tarski is an algebraic closure operator Definition 5.4 A closure operator ... subuniverses of A, is an algebraic lattice The corollary says that the subuniverses of A, with ⊆ as the partial order, form an algebraic lattice Definition 3.4 Given an algebra A, Sub (A) denotes the set of ... we say ≤ is a total order on A A nonempty set with a partial order on it is called a partially ordered set, or more briefly a poset, and if the relation is a total order then we speak of a totally...
  • 331
  • 409
  • 0
Production and Cost in the U.S. Paper and Paperboard Industry pdf

Production and Cost in the U.S. Paper and Paperboard Industry pdf

Ngày tải lên : 01/04/2014, 00:20
... large range and a standard deviation which is at least an order of magnitude larger than that for labor and materials In the last year of the sample, the own price elasticity for energy was double ... reported model was uniformly superior to these specifications Also, models which accommodated factor augmentation for the variable and quasifixed factor of production were estimated In these alternative ... that capital K is quasi-fixed so that the interpretation of scale economies is more appropriately associated with capital stock utilization Derived from a Taylor series approximation around the...
  • 23
  • 625
  • 0
Báo cáo lâm nghiệp: "Composition of psocid taxocenoses (Insecta: Psocoptera) in Fageti-Piceeta s. lat. and Piceeta s. lat. forests in the Western Carpathian Mts" pps

Báo cáo lâm nghiệp: "Composition of psocid taxocenoses (Insecta: Psocoptera) in Fageti-Piceeta s. lat. and Piceeta s. lat. forests in the Western Carpathian Mts" pps

Ngày tải lên : 07/08/2014, 03:22
... dry to peaty habitats, hydricity of habitat does not correlate with altitude within collected material Habitats of the 7th AVZ are situated “higher” than habitats of the 8th AVZ in the graph of ... (indicators) as well These indicators are automatically selected by the program in compliance with species spectrum of particular vectors (habitats) to end parts of ordination axis Used modification ... all AVZ included habitats with high hydricity – flooded habitats, water logging and peaty habitats as well as dry or desiccate habitats Because every AVZ comprehends a large scale of habitats...
  • 8
  • 666
  • 0
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Ngày tải lên : 30/03/2014, 15:20
... GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA CCGGAATTCTTATTTCCCTTCTCTCATCTC GCGCGCCATGGAAAAAGATCTACAGTTAAGA GGGGGATCCCCATAATCCACTCCACCTGCTAAA GGGGGGGATCCT CATTATTTCCCTTCT AATACCGCCATGTATAATATCTATTACTTC GTAATAGATATTATACATGGCGGTATTGAA ... BamHI, and ligated with NcoI/BamHI restricted pET2 8a vector The ligation mixture was used to transform E coli DH 5a The plasmid that carried the oraS and oraE genes in the correct orientation was ... order to facilitate the amplication by PCR An NcoI site was introduced into the start of the oraS gene and a BamHI site into the end of the oraE gene Genomic DNA was purified from C sticklandii...
  • 5
  • 401
  • 0
báo cáo khoa học: "Engineering of the E. coli Outer Membrane Protein FhuA to overcome the Hydrophobic Mismatch in Thick Polymeric Membranes" pdf

báo cáo khoa học: "Engineering of the E. coli Outer Membrane Protein FhuA to overcome the Hydrophobic Mismatch in Thick Polymeric Membranes" pdf

Ngày tải lên : 11/08/2014, 00:23
... last amino acids of each of the 22 b-sheets prior to the more regular periplasmatic b-turns has been developed The pasted amino acids are expected to contain the same folding information as the ... strategy to elongate the hydrophobic portion of the protein leads still to a b-sheet folding, important for the channel functionality Based on the observation that the original FhuA Δ1-159 is able ... [26], the intermediate product (B) is used as a reporter with a characteristic adsorbance maximum at 370 nm The HRP was encapsulated into polymersomes and despite of using the Soret absorption band,...
  • 9
  • 438
  • 0
Canonical structures in potential theory -  s s  vinogradov, p  d  smith, e d  vinogradova

Canonical structures in potential theory - s s vinogradov, p d smith, e d vinogradova

Ngày tải lên : 17/03/2014, 14:41
... From a mathematical point of view, the study of Laplace’s equation has profoundly influenced the theory of partial differential equations and the development of functional analysis Together with the ... form of Laplace’s equation in some of these orthogonal coordinate systems, and the solutions generated by the classical method of separation of variables The formulation of potential theory for ... wave operator and the diffusion operator, its study and application continue to dominate many areas of mathematics, physics, and engineering Scattering of electromagnetic or acoustic waves is of...
  • 364
  • 261
  • 0
Báo cáo khoa học: " Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus" pps

Báo cáo khoa học: " Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus" pps

Ngày tải lên : 07/08/2014, 23:22
... pathologist unfamiliar with the treatment assignments Statistical analysis Health status, pathology, and total B lymphocytes were analyzed independent of STEC treatment, among STEC treatment groups ... the National Institutes of Health, and by grants from the United Dairymen of Idaho and the Idaho Beef Council References Asakura H, Makino S, Shirahata T, Tsukamoto T, Kurazono H, Ikeda T, Takeshi ... with the lack of correlation between STEC scores and weight gain in groups and 2, as opposed to group 3, and with the clustering of cases of poor health and tumor in group 1, that exhibited already...
  • 5
  • 248
  • 0
Báo cáo khoa hoc:" Failure of E. coli bacteria to induce preterm delivery in the rat" ppsx

Báo cáo khoa hoc:" Failure of E. coli bacteria to induce preterm delivery in the rat" ppsx

Ngày tải lên : 11/08/2014, 07:21
... infusion model in the rat A total of rats on days 14–18 of pregnancy underwent catheterization and immediate euthanasia to assess catheter position A separate group of 14 pregnant rats on gestational ... cannula was withdrawn and visualization continued for another 30 seconds to assess whether fluid leakage occurred The rat was then returned to her cage and allowed to awaken from anesthesia Original ... was joined to the barrel of the scope through a narrow channel created from strips of tape The tubing could be advanced or withdrawn for cannulation of the cervix under direct visualization The...
  • 7
  • 312
  • 0
Báo cáo khoa học: " Acute phase response in two consecutive experimentally induced E. coli intramammary infections in dairy cows" pptx

Báo cáo khoa học: " Acute phase response in two consecutive experimentally induced E. coli intramammary infections in dairy cows" pptx

Ngày tải lên : 12/08/2014, 18:22
... to be suitable inflammatory markers for bovine mastitis [25,26] LBP is a relatively new inflammatory indicator for mastitis [12] The aim of this study was to investigate APR in an experimental ... coordination among authors, TO carried out laboratory analyses of acute phase proteins, statistical analysis and interpretation of the results and drafted the manuscript, HJ and JS carried out the experiments ... intramammary challenges with E coli at an interval of two weeks Values are means for six cows with SEM represented by vertical bars Indicators of inflammation in the milk Milk SCC of the challenged...
  • 10
  • 269
  • 0
Báo cáo khoa học: "Transfer of immunoglobulins through the mammary endothelium and epithelium and in the local lymph node of cows during the initial response after intramammary challenge with E. coli endotoxin" ppt

Báo cáo khoa học: "Transfer of immunoglobulins through the mammary endothelium and epithelium and in the local lymph node of cows during the initial response after intramammary challenge with E. coli endotoxin" ppt

Ngày tải lên : 12/08/2014, 18:22
... IgM and BSA also at the endothelium in the lymph node (Fig 2B) This indicates a factor that is limiting the diffusion of IgM compared to that of BSA A plausible explanation is that the large ... to the standard procedure used at the laboratory of the Department of Clinical Chemistry, Swedish University of Agricultural Sciences, Uppsala, Sweden Statistical analysis The statistical analyses ... collection and laboratory analyses, prepared a first draft of the manuscript and participated in preparing the final manuscript Both authors read and approved the final manuscript Acknowledgements...
  • 10
  • 332
  • 0
Báo cáo y học: "Dramatic increase of third-generation cephalosporin-resistant E. coli in German intensive care units: secular trends in antibiotic drug use and bacterial resistance, 2001 to 2008" pot

Báo cáo y học: "Dramatic increase of third-generation cephalosporin-resistant E. coli in German intensive care units: secular trends in antibiotic drug use and bacterial resistance, 2001 to 2008" pot

Ngày tải lên : 13/08/2014, 20:22
... Statistical analysis The proportion of resistant isolates was calculated by dividing the number of resistant isolates by the total number of the isolates of the same species tested against the ... is therefore part of many antibiotic stewardship programmes A shift toward greater carbapenem usage harbours the risk of greater selection of carbapenem resistance and is associated with permeability ... DDD per patient per ICUday; that the burden of resistance increased dramatically for 3GC-resistant E coli and K pneumoniae over years, but not for MRSA; and that our data demonstrate the dangerous...
  • 9
  • 320
  • 0
Báo cáo y học: "DNA signatures for detecting genetic engineering in bacteria" ppt

Báo cáo y học: "DNA signatures for detecting genetic engineering in bacteria" ppt

Ngày tải lên : 14/08/2014, 08:20
... Figure of k-mers that are candidate signatures Percentage Percentage of k-mers that are candidate signatures The red line plots the percentage of candidate vector signatures as a function of k ... approved the final manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is the list of artificial vector identifiers ... signatures, but Figure shows that the signature set size levels off at k = 50 This means that longer signatures can be easily managed without creating a signature candidate pool that is too large...
  • 10
  • 433
  • 0
Báo cáo sinh học: "Comparative expression profiling of E. coli and S. aureus inoculated primary mammary gland cells sampled from cows with different genetic predispositions for somatic cell score" ppt

Báo cáo sinh học: "Comparative expression profiling of E. coli and S. aureus inoculated primary mammary gland cells sampled from cows with different genetic predispositions for somatic cell score" ppt

Ngày tải lên : 14/08/2014, 13:21
... with additional information obtained from the NetAffx annotation provided by Affymetrix Statistical analysis and bioinformatics After preprocessing of the microarray raw data, the BioConductor ... participated in the interpretation of the data and critically revised the manuscript SP, AH and DR participated in the microarray analyses and AH performed the miroarray experiments All authors ... including the ‘organization of the actin cytoskeleton’ and the ‘differentiation and proliferation of epithelial cell lines’ (FSCN1) as well as the ‘nuclear assembly’, the ‘chromatin organization’ and...
  • 17
  • 298
  • 0