generalize the aligned basis description of a projector to show that the structure is very similar for oblique projections except that the aligned basis is non orthonormal
Báo cáo y học: "The Colombian conflict: a description of a mental health program in the Department of Tolima" pdf
Ngày tải lên :
13/08/2014, 14:20
... rural population about the symptoms and consequences of traumatic events, to offer tips and advice on coping mechanisms, and an explanation of the mechanisms of psychotherapy At the end of the ... responsibility for the accuracy of the data analysis GC and MRM participated in the interpretation of the results GC, SH, RFG and MRM participated in the critical revision of the manuscript All authors read ... clinical status improved on their last visit The absence of a control group did not allow us to develop comparative analysis and therefore we cannot state that this improvement is due solely to the...
- 6
- 317
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
Ngày tải lên :
26/01/2014, 10:20
... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... two-dimensional array This solution presents an ADO.NET method, which is also called GetRows( ), that duplicates the functionality of the ADO GetRows( ) method The prototype for the ADO.NET method is: ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and...
- 5
- 309
- 0
REPRODUCTIVE CHARACTER DISPLACEMENT AND SPECIATION IN PERIODICAL CICADAS, WITH DESCRIPTION OF A NEW SPECIES, 13-YEAR pot
Ngày tải lên :
28/03/2014, 16:20
... zone is derived No trends exist in allopatry that can explain the pattern of displacement; rather, the displacement is associated with the zone of sympatry In Illinois and eastern Missouri, nearly ... Calvert County, Maryland, provided tape recordings and distributions of Magicicada in Maryland We are indebted to the Harold E Alexander Wildlife Management Area, Sharp County, Arkansas, and to ... (each) orange with black lateral band or center mostly orange orange with black lateral band or center black, rarely with weak2 orange lateral band black, rarely with weak2 orange lateral band...
- 13
- 489
- 0
báo cáo hóa học:" Improving accuracy of total knee component cementation: description of a simple technique" ppt
Ngày tải lên :
20/06/2014, 04:20
... femoral and patellar peg holes Badley EM, Wang PP: Arthritis and the aging population: projections of arthritis prevalence in Canada 1991 to 2031 J Rheumatol 1998, 25(1):138-144 Gignac MA, Davis AM, ... maximize patient safety We hope that our practical note may facilitate and assist other surgeons performing TKAs on a routine basis Competing interests The authors declare that they have no competing ... surfaces are prepared for cementation in the choosen standard fashion At this point, the cancellous bone around the tibial keel, as well as the peg holes for the patella and femoral components are...
- 4
- 247
- 0
Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx
Ngày tải lên :
21/06/2014, 11:20
... successful frame delivery in a link The path cost is the sum of the link costs of the path The metric takes into consideration the quality of all the links of a path Note that LETX has the same aim as ... enable the calculation of the cost of a path, based on the LQI values of all links Therefore, we chose to evaluate the performance of these LQI-based routing metrics for NST-AODV Note that the ... Experimental Characterization In this section we present an experimental study of the use of the LQI as an estimator of the LDR, to identify the potential advantageous and adverse characteristics of the...
- 20
- 397
- 0
Báo cáo hóa học: " Research Article Description of a 2-Bit Adaptive Sigma-Delta Modulation System with Minimized Idle Tones" docx
Ngày tải lên :
22/06/2014, 19:20
... Speech, and Signal Processing (ICASSP ’01), vol 4, pp 2621–2624, Salt Lake City, Utah, USA, May 2001 [6] M A Aldajani and A H Sayed, “Stability and performance analysis of an adaptive sigma-delta modulator,” ... (upper graphs in Figures 4 (a) and 4(b)), but the autocorrelation estimation reveals again a tonal behavior with a noise pattern repeated at every 256 samples (Figure 4(c)) Similarly, the 2-bit ASDM’s ... idle tones despite dithering The mechanism behind this major and advantageous operational characteristic of the proposed system is not profound, since neither the memory nor the look-ahead feature...
- 6
- 280
- 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt
Ngày tải lên :
09/08/2014, 20:20
... suggests that Placozoa are basal relative to all other non- Bilaterian animals ([70], but see [71]) Whole genome analysis of placozoan T adhaerens shows that the placozoan genome has the lowest amount ... analysis SW, EM and MVM drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available with the online version of this article: ... constructed for a reef-building coral, Acropora millepora This map has ample resolution for QTL analysis (3.4 cM) and represents the first linkage map for a coral, as well as for any non- bilaterian multicellular...
- 17
- 268
- 0
Báo cáo y học: "A description of a knowledge broker role implemented as part of a randomized controlled trial evaluating three knowledge translation strategies" potx
Ngày tải lên :
11/08/2014, 05:21
... development, maintenance, and facilitation; facilitation of individual capacity development in EIDM; and facilitation of and support for organizational change Individual and organizational assessment Baseline ... was transferred to the public health decision makers in ways that were most useful to them, and assisting them in translating that evidence into local practice This was accomplished primarily ... promoting the integration of the best available evidence into policy and practice-related decisions A key attribute of the KBs is their skill in the interpretation and application of research The KB also...
- 9
- 316
- 0
báo cáo khoa học: " A description of a knowledge broker role implemented as part of a randomized controlled trial evaluating three knowledge translation strategies" pps
Ngày tải lên :
11/08/2014, 16:20
... development, maintenance, and facilitation; facilitation of individual capacity development in EIDM; and facilitation of and support for organizational change Individual and organizational assessment Baseline ... was transferred to the public health decision makers in ways that were most useful to them, and assisting them in translating that evidence into local practice This was accomplished primarily ... promoting the integration of the best available evidence into policy and practice-related decisions A key attribute of the KBs is their skill in the interpretation and application of research The KB also...
- 9
- 295
- 0
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
Ngày tải lên :
12/08/2014, 22:22
... provided that the A potential criticism of the partitioning approach is that it may offer the same information as the anion gap This is partly true, provided that the anion gap is corrected for albumin ... first draft of the manuscript AD participated in the design of the study, derived one of the base deficit formulae and advised on data analysis JA performed data collection IAM supervised the project ... this was predominantly due to the alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit +2.9; Table 1) This is also shown in the histogram for BDalb (Fig 1a) , showing an...
- 7
- 325
- 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1
Ngày tải lên :
11/09/2015, 16:06
... by carbon atoms VI Calculations indicate that boron atoms preferentially bind at the step sites and at octahedral sites just below the surface Boron and carbon atoms hence show similar a relative ... preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands On-surface carbon atoms are relatively unstable with binding energies of around ... ammonia synthesis as a function of the adsorption energy of nitrogen for various transition metals and alloys 16 Figure 2.5 The calculaterd potential energy diagram for NH3 synthesis from N2 and...
- 18
- 257
- 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2
Ngày tải lên :
11/09/2015, 16:06
... the homogeneous literature The only difference here is that the availability and participation of other surface metal atoms that can assist the reaction on the surface The transition state takes ... experimentally that this alloy has an ammonia synthesis activity comparable to that of the best industrial catalysts (Jacobsen et al., 2002; Boisen et al., 2002) 17 The maximum of the volcano curve is ... to ethane is remarkably similar to that for ethyl In fact, most of the hydrogenation reactions that have been examined in the literature are quite similar The important point is that the active...
- 159
- 575
- 0
Development of a method to measure consumer emotions associated with foods
Ngày tải lên :
03/04/2013, 21:07
... such as pizza, chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, ... small portion of the sample A 2–3 break between samples is enforced, as well as palate rinsing with filtered water, and unsalted crackers The amount of time required to evaluate each sample averaged ... within the laboratory (CLT) and also internet testing Thomson (2008) has also argued that concepts such as satisfaction are more appropriate than simple acceptance for commercial products, and that...
- 10
- 781
- 3
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
Ngày tải lên :
22/12/2013, 08:58
... along the axial distance for (a) mirror magnetic field, and (b) flat magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma chamber The measured magnetic ... Hannurkar P R 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma ... offers a continuous control of the axial magnetic field, giving tuning capability The fine tuning the magnetic field is very important for the stability of an ECR plasma source, as any small change...
- 8
- 650
- 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf
Ngày tải lên :
15/02/2014, 01:20
... 5¢-TAGCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ 5¢-AAAGGTTTCTTCAAGCCGGCCATGGCTTCCCTT-3¢ 5¢-CCTGACGATTCTAAACCGTTCTTCAAGCCGG CCATGGCTTCCCTT-3¢ a The restriction sites EcoRI and ... with at least three replicates The Km and kcat values were calculated by nonlinear regression using graphpad prism 5.0 (GraphPad Software Inc., La Jolla, CA, USA) Thermostability assay of WT and ... which indicated that the structure of G194P was more stable than that of the WT enzyme, as shown in Table The structural stability induced by the G194P mutant was mainly a result of the enhanced electrostatic...
- 8
- 740
- 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
Ngày tải lên :
08/03/2014, 10:20
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
- 11
- 501
- 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf
Ngày tải lên :
23/03/2014, 13:20
... from the preparation The binding of ferritin with microtubules in the presence of the total MAP fraction was also assayed under the same conditions, except that the total MAP fraction was added to ... MAP2 and Tau) were added to the ferritin ⁄ tubulin reaction mixtures, instead of the total MAPs (data not shown) Furthermore, Katsuki et al [8] showed that the addition of an excess amount of ... by the appearance of a blue color, and was compared with the electrophoretic patterns and the spectrophotometric observations of all fractions Upper panel, plot showing the absorbance of all of...
- 10
- 232
- 0
Báo cáo y học: " Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan" pptx
Ngày tải lên :
12/08/2014, 01:21
... 10.7 – – – – – Sampling Sites: Karasuma Pen., Kita-Yamada, Yabase Kihan Is. , Ohashi Marina, Wani Fishing Port, Aoyagi Beach, Shirahige Beach, Shin-Asahi Windmill Village, Lake Yogo (also see Fig ... that effectively cut CvV-BW1 DNA (Enzymes II) Restriction enzyme Recognition sequence BglII AGATCT DraI TTTAAA EcoRV NdeI GATATC CATATG MssI GTTTAAAC Sau3AI GATC SspI ACTAGT SwaI ATTTAAAT XbaI ... serial dilution Plaque assay and virus isolation Figure Schema of PBCV infection of the symbiotic algae of Paramecium *Paramecium possessing Chlorella variabilis has been reported in Japan, China,...
- 10
- 304
- 0
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx
Ngày tải lên :
13/08/2014, 01:20
... CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA The DKK1b primer pair was used for standard PCR amplification of cDNA prepared with the DKK 1a- R primer Forty and ... 5′-TGCCTGAGATTGCTCGGATCTACA; UBE2D2-R, 5′-ACTTCTGAGTCCATTCCCGAGCTA; Tax-F, 5′-ATGGCCCACTTC CCAGGGTTTGGA; Tax-R, 5′-ACCAGTCGCCTTGTACACAGTCTC; HBZ-S1-F, 5′- TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ... spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira...
- 16
- 460
- 0