general purification of proteases as a class
A contrastive analysis of encouraging as a speech act in english and vietnamese
... describes and analyzes the syntactic and pragmatic features of 2.2.2.2 Classifications of speech acts directives in English and Vietnamese Searle (1975) has set up the following classification of Trương ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language,...
- 13
- 1,583
- 8
Tài liệu The Man of Letters as a Man of Business docx
... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...
- 21
- 544
- 0
Tài liệu Test of English as a Foreign Language doc
... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...
- 36
- 869
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...
- 10
- 483
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...
- 8
- 426
- 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt, ... CRT(6–332), has been determined by X-ray crystallography [41] Based on these data, CRT has a globular and compact lectin-like domain encompassing the classical N-domain residues 1–170 as well as residues...
- 13
- 560
- 0
Animal waste utilization effective use of manure as a soil resource
... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... capacity as a standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders ... neither waste nor asset (Dittrich, 1993) Manure was largely viewed as a farm asset up until the early 1960s At that time the theme of manure as a waste, as something to be disposed of, began to...
- 319
- 5,613
- 0
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/small_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... protein was precipitated and washed carefully with methanol–chloroform [31] The protein concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation...
- 10
- 477
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...
- 28
- 764
- 2
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identification of the reaction ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...
- 17
- 440
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
... the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital status, educational level ... sex, martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher ... activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities...
- 9
- 844
- 0
Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf
... elemental analysis of samples Sample EF FW Table Elemental analysis of graphite and graphite-g-TMPBA Sample Elemental analysis Elemental analysis C (%) H (%) C (%) O (%) As- received graphite Pyrene ... 700 amu The covalent attachment of TMPBA onto pyrene could be confirmed by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) analysis (Fig 2) A series of peak groups appeared, ... the purpose of having a basic understanding of the starting material, pristine graphite was characterized by elemental analysis (Table 2) When theoretical C H N O contents were calculated, the...
- 6
- 392
- 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Elliptic Systems in RN Involving the p x , q x -Laplacia" pptx
... x -Laplacian problems on a bounded domain,” Journal of Mathematical Analysis and Applications, vol 306, no 2, pp 604–618, 2005 17 X.-L Fan, Q Zhang, and D Zhao, “Eigenvalues of p x -Laplacian ... of the calculus of variations and elasticity theory,” Izvestiya Akademii Nauk SSSR Seriya Matematicheskaya, vol 50, no 4, pp 675–710, 1986 Russian 14 C O Alves and M A Souto, “Existence of solutions ... solutions of the system P,Q Theorem 3.5 The system P,Q has at least one nontrivial solution u, υ Proof By Lemmas 3.3 and 3.4, we can apply the mountain pass theorem to obtain that the system P,Q has...
- 16
- 288
- 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Weighted p t -Laplacian System Multipoint Boundary Value Problems" doc
... Zhang, “Existence of positive solutions for a class of p x -Laplacian systems,” Journal of Mathematical Analysis and Applications, vol 333, no 2, pp 591–603, 2007 12 Q Zhang, “Existence of radial ... 585–594, 2003 X.-L Fan, Q Zhang, and D Zhao, “Eigenvalues of p x -Laplacian Dirichlet problem,” Journal of Mathematical Analysis and Applications, vol 302, no 2, pp 306–317, 2005 A El Hamidi, “Existence ... t a −1 a h t m−2 i αi h t dt dt − e1 2.14 Journal of Inequalities and Applications From Lemma 2.1, it is immediate that Λh a1 − Λh a2 , a1 − a2 > 0, for a1 / a2 , 2.15 and hence, if 2.11 has a...
- 18
- 222
- 0
Báo cáo hóa học: " Research Article Extinction and Decay Estimates of Solutions for a Class of Porous Medium Equations" pptx
... Journal of Mathematical Analysis and Applications, vol 228, no 2, pp 483–494, 1998 [7] S L Chen, “The extinction behavior of the solutions for a class of reaction-diffusion equations,” Applied Mathematics ... Journal of Inequalities and Applications methods and an eigenfunction argument But as far as we know, few works are concerned with the decay estimates of solutions for the porous medium equation ... “Periodic solutions of evolution m-laplacian equations with a nonlinear convection term,” International Journal of Mathematics and Mathematical Sciences, vol 2007, Article ID 27368, 10 pages, 2007 Wenjun...
- 8
- 308
- 0
Báo cáo hóa học: " Research Article On the Sets of Regularity of Solutions for a Class of Degenerate Nonlinear Elliptic Fourth-Order Equations with L1 Data" doc
... Kovalevsky and F Nicolosi, “On the sets of boundedness of solutions for a class of degenerate nonlinear elliptic fourth-order equations with L1 -data,” Fundamentalnaya I Prikladnaya Matematika, ... continuity of solutions of equations and variao tional inequalities with degenerate nonlinear elliptic high order operators,” in Problemi Attuali dell’Analisi e della Fisica Matematica, pp 205–220, Aracne ... Viale delle Scienze, 90128 Palermo, Italy Email address: bonafedes@unipa.it F Nicolosi: Dipartimento di Matematica e Informatica, Universit` delgi Studi di Catania, a Viale A Doria 6, 95125 Catania,...
- 15
- 291
- 0
Báo cáo hóa học: "CONVERGENCE AND PERIODICITY OF SOLUTIONS FOR A CLASS OF DIFFERENCE SYSTEMS" potx
... of Mathematics and Econometrics, Hunan University, Changsha, Hunan 410082, China E-mail address: lhhuang@hnu.net.cn Guang Zhang: Department of Mathematics, Qingdao Institute of Architecture and ... Equations: An Introduction with Applications, Academic Press, Massachusetts, 1991 [9] Y M Meng, L Huang, and K Y Liu, Asymptotic behavior of solutions for a class of neural network models of two ... Neurons with graded response have collective computational properties like those of two-state neurons, Proceedings of the National Academy of Sciences of the United States of America 81 (1984),...
- 10
- 300
- 0
Báo cáo hóa học: "EXISTENCE AND MULTIPLICITY OF SOLUTIONS FOR A CLASS OF SUPERLINEAR p-LAPLACIAN EQUATIONS" potx
... A class of superlinear p-Laplacian equations [19] , An application of a mountain pass theorem, Acta Mathematica Sinica 18 (2002), no 1, 27–36 [20] W Zou, Variant fountain theorems and their applications, ... Journal of Mathematical Analysis and Applications 193 (1995), no 3, 737– 755 [5] J V Goncalves and S Meira, On a class of semilinear elliptic problems near critical growth, International Journal of ... Proceedings of the Royal Society of Edinburgh Section A Mathematics 129 (1999), no 4, 787–809 [7] O A Ladyzhenskaya and N N Ural’tseva, Linear and Quasilinear Elliptic Equations, Academic Press,...
- 12
- 293
- 0
Báo cáo hóa học: " GENERIC CONVERGENCE OF ITERATES FOR A CLASS OF NONLINEAR MAPPINGS" pdf
... California, Santa Barbara, CA 931063080, USA E-mail address: sreich@math.ucsb.edu Alexander J Zaslavski: Department of Mathematics, The Technion – Israel Institute of Technology, 32000 Haifa, ... Reich and A J Zaslavski 217 Since n is an arbitrary natural number, we conclude that Ax − xA ≤ x − xA for each x ∈ K (3.14) Let > Choose a natural number n> (3.15) Property (P3) implies that B ... Department of Mathematics, The Technion – Israel Institute of Technology, 32000 Haifa, Israel E-mail address: sreich@tx.technion.ac.il Current address: Department of Mathematics, University of...
- 10
- 147
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25