0

gag of hiv 1 genome and sequencing the pcr products after cloning into a vector

Báo cáo y học:

Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx

Báo cáo khoa học

... conceived of the study, and participated in its design and coordination and writing of the manuscript All authors read and approved the final manuscript 10 11 12 13 Additional material 14 Additional ... participated to the neutralization and binding assays AA participated in the design of the study and writing of the manuscript BL and FC performed the neutralization assays involving ENF-resistant ... displays an IC50 value in the nM range against some laboratoryadapted HIV- 1 isolates in vitro, and excellent efficacy in clinical trials [16 -18 ] However, it leads in vivo to the generation of viral...
  • 12
  • 304
  • 0
Báo cáo y học:

Báo cáo y học: "Turning up the volume on mutational pressure: Is more of a good thing always better? (A case study of HIV-1 Vif and APOBEC3)" pot

Báo cáo khoa học

... APOBEC3G Target APOBEC3F Target ATG(G) GAC CAG(G) ATG(G) TTG (A) GAG( A) GGA ATG(G) + + + + + Observed Mutant Codon Mutant Frequency ATA na CAA× ATA* TTA× AAG* AGA ATA 0.7 0.5 0.6 0 .1 0.3 0.5 0.7 ... structure of HIV- 1 and the distribution of APOBEC3G and APOBEC3F target sequence motifs across the HIV- 1 proteome APOBEC3G and APOBEC3F principally target "GG" (GG->AG) and "GA" (GA->AA) dinucleotides, ... Natl Acad Sci USA 19 96, 93: 610 6- 611 1 Kellam P, Larder BA: Retroviral recombination can lead to linkage of reverse transcriptase mutations that confer increased zidovudine resistance Journal of...
  • 8
  • 383
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Sargassum fusiforme fraction is a potent and specific inhibitor of HIV-1 fusion and reverse transcriptase" pot

Hóa học - Dầu khí

... macrophages, microglia, and astrocytes by Sargassum fusiforme AIDS Res Ther 2006, 3 :15 Hoshino T, Hayashi T, Hayashi K, Hamada J, Lee JB, Sankawa U: An antivirally active sulfated polysaccharide ... Cells 1G5 [11 ], SupT1 [12 ], and GHOST X4/R5 [13 ] cells were obtained from the HIV AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, and were cultured and maintained as specified ... Percent inhibition of HIV- 1 was calculated from raw data in (A) , utilizing the formula in the Methods, and plotted on the Y-axis as % HIV- 1 Inhibition Data are mean ± SD of three separate experiments...
  • 9
  • 438
  • 0
Retrovirology Research BioMed Central Open Access Modulation of HIV-1 infectivity and cyclophilin ppsx

Retrovirology Research BioMed Central Open Access Modulation of HIV-1 infectivity and cyclophilin ppsx

Báo cáo khoa học

... GGCCGCGTCTCCTTTGA 5'- AATCCTTTCTCTCCAGTGCTCAGA 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra) TRIM5α forward primer reverse primer Probe 5'- TGCCTCTGACACTGACTAAGAAGATG 5'- GGGCTAAGGACTCATTCATTGG 5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGATA(Tamra) ... 0.0 01 0. 01 NRC1 10 10 10 10 NRC9 200 200 15 0 Infectivity (% control) 0 .1 150 10 0 10 0 50 50 0 0.0 01 0. 01 0 .1 10 0.0 01 0. 01 NRC3 -1 0 .1 NRC3-5 200 200 15 0 15 0 10 0 10 0 50 50 0 0.0 01 0. 01 0 .1 10 0.0 01 ... iii) absence of resistance mutations in the protease RNA was purified from plasma, and the HIV- 1 sequence encompassing Gag and protease was amplified by RT -PCR using the primers ProC and BssHII The...
  • 15
  • 174
  • 0
Báo cáo y học:

Báo cáo y học: "Activation of HIV-1 expression and replication by cGMP dependent protein kinase type 1-β (PKG1β)" docx

Báo cáo khoa học

... Kuan-Teh Jeang's laboratory is supported in part by intramural funding from NIAID, NIH; and by the intramural AIDS targeted antiviral program (IATAP) from the Office of the Director, NIH We thank ... Jerebtsova M, Jackson A, Charles S, Klase Z, Southerland W, Gordeuk VR, Kashanchi F, Nekhai S: Phosphorylation of HIV- 1 Tat by CDK2 in HIV- 1 transcription Retrovirology 2006, 3:78 Sandberg M, Natarajan ... agonists and antagonists are available [23,24], practical chemotherapeutic interventions in these pathways (if they should be useful for anti-viral purposes) could be amenable Figure cGMP analogues...
  • 6
  • 231
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Imperfect DNA mirror repeats in the gag gene of HIV-1 (HXB2) identify key functional domains and coincide with protein structural elements in each of the mature proteins" doc

Hóa học - Dầu khí

... $2 -gag $3 -gag $4 -gag $5 -gag $6 -gag $7 -gag $8 -gag $9 -gag $10 -gag $11 -gag $12 -gag $13 -gag $14 -gag $15 -gag $16 -gag $17 -gag $18 -gag $19 -gag $20 -gag $ 21 -gag $22 -gag $23 -gag $24 -gag $25 -gag $26 -gag ... #3 -gag #4 -gag #5 -gag #6 -gag #7 -gag #8 -gag #9 -gag #10 -gag #11 -gag #12 -gag #13 -gag #14 -gag #15 -gag #16 -gag #17 -gag #18 -gag #1- NC #2-NC MA CA NC-p1-p6 MA CA NC p2 CA gag CA CA MA MA CA CA CA p6 MA NC ... #11 -gag #14 -gag #15 -gag #17 -gag MA CA p1 NC p2 CA CA CA CA NC 95 87 85 81 80 76 75 69 64 64 0270-aa ca-0364 0742-gg tg-0828 12 56-aa aa -13 40 11 71- aa ga -12 51 1065-ac ca -11 44 0 812 -at ta-0887 0920-ag...
  • 13
  • 538
  • 0
Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx

Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx

Báo cáo khoa học

... Natl Acad Sci USA 94, 3984–3989 61 Engelman, A. , Mizuuchi, K & Craigie, R (19 91) HIV- 1 DNA integration: Mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 12 11 12 21 62 Asante-Appiah, ... assembly and maturation via HIV- 1 protease-mediated cleavage of the C-terminal (RNase H) domain of a p66 subunit [ 31] A fascinating feature of the HIV- 1 RT heterodimer is the structural asymmetry ... inhibitors of DNA polymerization [58] HIV- 1 INTEGRASE Structure and function of HIV- 1 IN HIV- 1 IN is a polynucleotidyltransferase that catalyzes the integration of the DNA copy of the viral genome into...
  • 9
  • 494
  • 0
Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Báo cáo khoa học

... 9 410 8 9 811 2 11 012 4 11 813 2 12 213 6 12 614 0 15 416 8 15 817 2 16 217 6 16 618 0 17 018 4 17 418 8 18 219 6 18 6200 210 224 214 228 218 232 222236 238252 242256 246260 HIV IN residues 9 410 7 9 811 6 12 614 5 13 014 9 13 915 3 ... Engelman A, Mizuuchi K & Craigie R (19 91) HIV- 1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 12 111 2 21 FEBS Journal 278 (2 011 ) 316 330 ê 2 010 The Authors Journal ... 3Â-processing substrate (5Â-[FAM]-ACTGCTAGAG ATTTTCCACGTGGAAAATCTCTAGCAGT-[DABCYL] -3Â) or control substrate (5Â-[FAM]-TGCTAGAGATTTTC CACGTGGAAAATCTCTAGCA-[DABCYL]-3Â) The uorescence signal was continuously...
  • 15
  • 343
  • 0
báo cáo hóa học:

báo cáo hóa học: " Lipopolysaccharide-enhanced transcellular transport of HIV-1 across the blood-brain barrier is mediated by luminal microvessel IL-6 and GM-CSF" potx

Toán học

... experimental animals were approved by the local Animal Care and Use Committee and were performed in a facility approved by Association for Assessment and Accreditation of Laboratory Animal Care Cerebral ... luminal chamber significantly increased 13 1 I -HIV- 1 permeability of BMEC monolayers (Fig 1A and 1C) and decreased TEER (Fig 1B and 11 1D) The presence of antibodies to IL-6 and GM-CSF (10 µg/mL, ... (National Institute of Health, Bethesda, MD) and then normalized by that of each loading control protein Statistical analysis Values are expressed as means ± SEM One-way and two-way analysis of...
  • 37
  • 447
  • 0
báo cáo hóa học:

báo cáo hóa học:" Substitutions in the Reverse Transcriptase and Protease Genes of HIV-1 Subtype B in Untreated Individuals and Patients Treated With Antiretroviral Drugs" potx

Hóa học - Dầu khí

... from a T A transversion In contrast, only 14 .7% harbored D30N and 11 .7% harbored M46I, both of which result from a G A transition Among all ARV-treated patients, 76.4% harbored M184V and 31. 3% harbored ... associated with drug resistance Again, we observed a decrease in prevalence of G A transitions and even an increased prevalence of A G transitions The clinical importance of the G A hypermutation ... uracil The activity of APOBEC3G is inhibited by the Vif protein.[5,7,8] In the absence of Vif, the synthesis of the negative strand of DNA can result in the insertion of a uracil as a result of...
  • 6
  • 286
  • 0
báo cáo hóa học:

báo cáo hóa học:" The HIV-1 Non-subtype B Workgroup: An International Collaboration for the Collection and Analysis of HIV-1 Non-subtype B Data" pot

Hóa học - Dầu khí

... type reverse transcriptase and protease mutation search engine for queries Nat Med 2000, 6 :12 90 -12 92 Abstract Van Laethem K, De Luca A, Antinori A, Cingolani A, Perna CF, Vandamme AM: A genotypic ... HIV- 1 Nomenclature Proposal: A Reference Guide to HIV- 1 Classification Human Retroviruses and AIDS: A Compilation and Analysis of Nucleic and Amino Acid Sequences 2000:492-505 [http://www .hiv. lanl.gov/content/ ... of the International AIDS Society 2005, 7: 71 10 11 12 13 14 15 http://www.jiasociety.org/content/7 /1/ 71 Kantor R, Katzenstein D, Camacho R, et al.: Genotypic analyses of RT and protease sequences...
  • 3
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Sequence similarity between the erythrocyte binding domain 1 of the Plasmodium vivax Duffy binding protein and the V3 loop of HIV-1 strain MN reveals binding residues for the Duffy Antigen Receptor for Chemokines" ppsx

Báo cáo khoa học

... create this construct were 5’CAA AAT CAG CTG ATG AAA AAC TGT AAT TAT3’ and 5’CAA ATT GGG CCC TTC CTT CAT ACA TAA TTG3’ and contain the restriction sites for Apa I and Pvu II The pHVDR22 plasmid ... CGA GAA AAG CTC GGG AAG CAG ATT GG3’ and 5’ CCA ATC TGC TTC CCG AGC TTT TCT CGC ATA ATT AC3’ These primers also introduce an Ava I site as a silent mutation for screening pv22KAKA The Stratagene ... in the heparin binding consensus site at amino acids 217 -226 from YKRKRRERDW to YKRARRERDW 5’CTC TTT CCC GAC GAG CTC TCT TAT AAT TAC AG3’ and Page of 10 5’CTG TAA TTA TAA GAG AGC TCG TCG GGA AAG...
  • 10
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: " Peptides derived from the HIV-1 integrase promote HIV-1 infection and multi-integration of viral cDNA in LEDGF/p75-knockdown cells" doc

Báo cáo khoa học

... generate a standard calibration curve, the SVC 21 plasmid containing the full-length HIV- 1HXB2 viral DNA was used as a template In the first-round PCR, the LTR-Tag-F and LTR-R primers were used and ... Integrated HIV- 1 sequences were amplified by two PCR replication steps using the HIV- 1 LTR-specific primer (LTR-Tag-F 5′-ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG-3′) and Alu-targeting primers (firstAlu-F ... cell–in the case of HeLa P4 cells treated with 200 μM INS and infected by a ΔRev HIV- 1 reflects integration of practically all of the available viral cDNA copies The number of cDNA copies generated...
  • 11
  • 284
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The inhibition of assembly of HIV-1 virus-like particles by 3-O-(3'''',3''''-dimethylsuccinyl) betulinic acid (DSB) is counteracted by Vif and requires its Zinc-binding domain" pdf

Báo cáo khoa học

... panels (a) and (b) (c), Quantification of Gag and Vif proteins in WCL (IC -Gag, intracellular Gag; IC-Vif, intracellular Vif) and extracellular VLP, using SDSPAGE and radio-immunoblotting Gag and ... were quantified by autoradiography of immunoblots reacted with anti -Gag and anti-Vif rabbit primary antibodies and 35S-labelled secondary anti-rabbit IgG antibody After autoradiography of the blots, ... Pr5 5Gag alone (Fig 6Bii, and Fig 6C) These results suggested that the antagonistic activity of Vif against the DSB inhibition of Gag assembly, absent from VifS 116 V and VifC133S mutants, was associated...
  • 18
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx

Báo cáo khoa học

... reverse for Tat1:← 17 18 and for Tat2:← 17 70) TatXbaI sense 5' ATATATTCTAGAGGTCTCTCTGGTTAGACCAGATC 3' (exon 1: for Tat1 et Tat2 :1 ) TatXbaI rev 5' TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 ... (exon1: sense for Tat1 and for Tat2 :10 4 →) SDEcoRI sense 5' ATATAAGAATTCCGAGGGGCGGCGACTG 3' (exon1: sense for Tat1 and for Tat2:274→) AUGEcoRI sense 5' TATAATAGAATTCATGGAGCCAGTAGATCCTAGACTAGAG ... for Tat1:343 → and for Tat2:396 →) TatNcoI sense 5' TAATATACCATGGGGTCTCTCTGGTTAGACCAGATC 3' (exon1: sense for Tat1 and for Tat2 :1 ) TatSmaI rev 5' TATATACCCGGGAGTACAGGCAAAAAGCAGCTGCTTATATGC 3'...
  • 18
  • 240
  • 0
Báo cáo y học:

Báo cáo y học: " Biochemical and virological analysis of the 18-residue C-terminal tail of HIV-1 integrase" pot

Báo cáo khoa học

... by annealing AE3697 (5'-PO4TCGACAGGAGATGGACAGCGGAAGTCACCTGGAGGG Page of 13 (page number not for citation purposes) Retrovirology 2009, 6:94 CGCAAGAGAGGACGGTGAGATGGCATAAG) with AE3698 (5'-PO4GATCCTTATGCCATCTCACCGTCCTCTCTTGCGCCCTC ... (5'-ACAGGATGAGGATTAACTGATGATAAGCTTTAGTAAAACACCATATG)/AE1065 (5'CATATGGTGTTTTACTAAAGCTTATCATCAGTTAATCCTCATCCTGTC) IN deletion mutations were subsequently constructed in pUCWTpol3stop or pKBIN6Hthr by PCR ... XhoI-tagged AE3699 (5'TGGTGCTCGAGTGCGGACCCACGCGGGACGAGTGCCATCTCACCGTCCTCTCTTGC) and AflII-tagged AE3700 (AACATCTTAAGACAGCAGTAC) and the resulting digested fragment was ligated with XhoI/AflII-cut...
  • 13
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

Báo cáo khoa học

... CTGGAACKCTAGTTGGAGTAAT MO042 gag p24 OF- 1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF- 2 508 - 527 AACCCACTGCTTAAGCCTCA MO044 gag p24 OR 2272-2252 TGCCAAAGAGTGATTTGAGGG MO043 gag p24 IF 10 48 -10 67 ... TGYGTRCATCAAARGATAGA MO045 gag p24 IR 211 8- 210 1 CCCCTTGYTGGAAGGCCA MO034 5’ LTR to gag p24 OF 478 - 479 TGAGCCTGGGAGCTCTCTG MO186 p24 to env OF 19 58 - 19 85 TTAARTGTTTCAACTGTGGCAAAGAAGA MO187 p24 ... 6445 CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT MO1 91 5’ LTR to gag p24 OR 832 - 859 AATGCTGWRAACATGGGTATTACTTCTG...
  • 14
  • 334
  • 0
Báo cáo y học:

Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt

Báo cáo khoa học

... linkage analysis of the single genomes at 4, 17 and 37 months showed that the patient acquired the Q151M MDR mutations in the order: A6 2V, V75I and finally Q151M (Table 1) The emergence of Q151M ... V 10 0 I L 210 V90 NNRTI E138 Y1 81 V100 F87 V SF 20 I A1 00 I100 I A1 00 I100 M230 L I100 A1 00 I100 A1 00 I100 Y70 H2 21 N348 N100 10 0 T69 Y100 10 0 I100 I3 L94 I 31 L100 A3 3 V97 T48 S100 S68 K102 G100 ... (5’-GCAGGGCCCCTAGGAAAAAGGGC-3’) and CRhINClaIR1 (5’-CCTTATCGATTCCATCTAGAAATAGC-3’) Similarly, HpaI (flanking RT amino acids 288/289) and SpeI (flanking RT amino acids 423/424) sites were introduced and any...
  • 11
  • 350
  • 0
Báo cáo y học:

Báo cáo y học: "Conformational alterations in the CD4 binding cavity of HIV-1 gp120 influencing gp120-CD4 interactions and fusogenicity of HIV-1 envelopes derived from brain and other tissues" pptx

Báo cáo khoa học

... interactions and fusogenicity of HIV- 1 envelopes derived from brain and other tissues Lachlan Gray1,2, Jasminka Sterjovski1, Paul A Ramsland3,4,5, Melissa J Churchill1,6 and Paul R Gorry1,7,8* Abstract ... Lewin SR, Ramsland PA, et al: HIV- 1 escape from the CCR5 antagonist maraviroc associated with an altered and less efficient mechanism of gp120-CCR5 engagement that attenuates macrophagetropism ... UK1-BR UK7-BR R5 R5 Yes Yes All R5 All R5 The clinical and neuropathological details of the study subjects, and the derivation and characterization of the primary tissue derived HIV- 1 isolates...
  • 10
  • 1,169
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25