... concentration than GDP This exchange of the G- protein- bound GDP for GTP induces a conformational change in the switch region of Gand causes the dissociation of G from the G γ dimer The GandG subunits ... [39,226–231] Gs Gq RLXN, Cyt, GI CXN CLT1R ET-A/B EDG 1–7 EP2 H1 histamine IP Prostacyclin [232–236] [237–242] [38,243–245] [20,246,247] [248,249] [41,250] Gq Gq Gq, Gi, G1 2/13 Gs Gq Gs CXN, GP CXN, GP GS, ... novel mitogenic signaling events and define cooperativity between GPCRs and receptor tyrosine kinases in mediating ASM growth G1 2/13 coupledreceptors Signaling via activation of the G1 2/13 family...
... modeling of GPCRs at different activation states automatic modeling of GPCRs at different activation states, and docking odorant ligands II WEB-BASED SERVER FOR AUTOMATICALLY HOMOLOGY MODELING AND ... the ligands AutoDock Vina is a new open-source program for drug discovery, molecular docking and virtual screening, offering multi-core capability, high performance and enhanced accuracy and ease ... CHARACTERIZATION OF GPROTEINCOUPLEDRECEPTORS 47 Fig The lowest Autodock VINA affinity of docked ligands generated by the receptor built by template 3rze, although their DOPE and GA341 scores are...
... Class C G- protein- coupledreceptors ligand binding This led to the demonstration that most GPCRs can oligomerize as shown by both biochemical and energy transfer technologies [3] In recent ... occurs in the GABAB receptor, GABA binding in the GABAB1 VFT leading to activation of the GABAB2 HD Although GABAB1 VFT binds the agonist and the GABAB2 HD couples to G- protein, a chimeric construct ... of class C GPCRs as well as the C-terminal tail are involved in G- protein coupling For various class C GPCRs, including the mGlu5, GABAB2 and CaS receptors, the HD can fold correctly and be trafficked...
... (2002) G- proteincoupled receptor oligomerization and its potential for drug discovery Nature Rev Drug Discovery 1, 808–820 12 Milligan G (2004) G protein- coupled receptor dimerization: function and ... signal was obtained with increasing energy acceptor ⁄ energy donor ratios Saturation curves so generated resemble ligand ⁄ GPCR binding curves and, as such, the ratio of energy acceptor ⁄ energy ... (2000) Oligomerization of l- and d-opioid receptors J Biol Chem 275, 26128–26135 57 Devi LA (2001) Heterodimerization of G- protein- coupled receptors: pharmacology, signaling and trafficking Trends...
... native ligand is a small molecule Previously, peptide ligands and small neurotransmitter-like molecules were coupled to QDs resulting in specific interactions with the target receptorsand drug transporters ... using covalently tethered nucleoside agonist ligands Various approaches to the linking chemistry and the nature of the spacer group and solubilizing groups were compared The QD nucleoside conjugates ... affinity depended greatly on the type of coating and covalent linkage to the QD Conjugates tethered as monovalent attachments through amide-linked chains and PEG dis- Figure General design features...
... following primers: M2-goa1-s, 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ (An engineered PstI recognition ... conditions Human GPCR activates nematode Gprotein construct, pPAK-M2–Gai1 [25], as a template with the following primers: M2-myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC ... 1986 [23] Although Gb and Gc are essential for Ga activation by GPCR [10], GPCR can activate Ga without Gb and Gc in some GPCR::Ga fusion proteins [24] Muscarinic-agonist-dependent Ga activation...
... either through matrix metalloproteinases (Gi ⁄ o-, Gq-, and Gs -coupled receptors) or through Rho ⁄ Rho-associated kinase (Rock)-mediated expression of RTK ligands (G1 2 ⁄ 13 -coupled receptors) ... activation G1 2 ⁄ 13-, Gi ⁄ o-, Gq-, and Gs -coupled receptors are all known to activate the phosphoinositide 3-kinase (PI3K) ⁄ Akt pathway through either Ga or Gbc subunits Gaq and Gas subunits ... depression and pain [18] GPCRs preferentially couple to heterotrimeric G proteins (consisting of a, b and c subunits) that are grouped into four classes, known as Gaq ⁄ 11, Gai ⁄ o, Gas and Ga12 ⁄...
... following primers were used for cloning at the pLEGFP-N1 vector: GPR30-forward 5¢-TAATAAGTCGACGGGTC TCTTCCT-3¢ and GPR30-reverse 5¢-ATTATTGGATC CTACACGGCACTGC-3¢ Viruses capable of introducing pLEGFP-N1, ... 5¢-ATCTCCAAGGCAA GATCA-3¢ and reverse primer 5¢-GTGCCATCAGA CAAGGAA-3¢ were used Primer pair resulted in a PCR product of 216 bp Additionally, forward primer 5¢-GAGCCCCAAGAAGAAAGA-3¢ and reverse ... or anti-b-actin (Sigma) Peroxidase-conjugated goat anti-rabbit IgG (Cappel, West Chester, PA, USA) for GR and peroxidase-conjugated goat anti-mouse IgG (Cappel) for PR, ER and b-actin were used...
... may form hetero-oligomers [5] The same phenomenon has been shown to occur in hetero-oligomers formed by Gi -coupled and Gq -coupled receptors [6] and by Gs -coupled and Gq -coupled receptors [7] One ... activate a G- protein, leaving their coupling efficacy unchanged For instance, b2-adrenergic receptors, which are coupled with stimulatory G- proteins, and d-opioid and j-opioid receptors, which are coupled ... interaction and ERK1 ⁄ signaling is shown in Fig Regardless of the mechanism by which b -arrestins bind to GPCRs, the signaling pathway activated by these proteins is another way by which GPCR heterooligomerization...
... Vriend G (2003) Sequence analysis reveals how G protein- coupledreceptors transduce the signal to the Gprotein Proteins 52, 553–560 Madabushi S, Gross AK, Philippi A, Meng EC, Wensel TG & Lichtarge ... structure of G- protein- coupledreceptors J Med Chem 40, 3871–3886 Gouldson PR, Snell CR, Bywater RP, Higgs C & Reynolds CA (1998) Domain swapping in G- proteincoupled receptor dimers Prot Eng 11, 1181–1193 ... 1181–1193 Gouldson PR, Higgs C, Smith RE, Dean MK, Gkoutos GV & Reynolds CA (2000) Dimerization and domain swapping in G- protein- coupled receptors: a computational study Neuropsychopharmacology 23,...
... P2, 5¢-ACTGTCGCTGGAGTTCCCAGAGGAATCTTGG CG-3¢ (nucleotides 1677–1709, antisense) Complementary DNAs encoding the C-terminal mGRK6-A mutants M2 and M3 were prepared either from the mGRK6-A mutant ... (nucleotides 1–26, sense, initiating ATG underlined) in combination with antisense primers introducing a stop codon sequence: mGRK6-A M2: P2, 5¢-CTAGTCGC TGGAGTTCCCAGAGGAATCTTGGCG-3¢ (nucleotides 1677–1706, ... proteins were visualized by SDS ⁄ PAGE and autoradiography of the gel Miscellaneous Protein concentrations were determined according to Bradford [44] using bovine IgG as standard SDS ⁄ PAGE and...
... following primers (Amersham Pharmacia Biotech) were used for PCR: GPR30-forward, 5¢-AGTCGG ATGTGAGGTTCAG-3¢; GPR30-reverse, 5¢-TCTGTGT GAGGAGTGCAAG-3¢; TBP-forward, 5¢-TTTGGAAG AGCAACAAAGG-3¢; ... AGCAACAAAGG-3¢; TBP-reverse, 5¢-AAGGGTGCAG TTGTGAGAG-3¢ TBP was used to normalize the RNA samples These primer pairs result in PCR products of 240 bp (GPR30) and 243 bp (TBP) LightCycler data were quantitatively ... tissues [12–14], and some G protein- coupledreceptors are known to be involved in growth regulation The regulation of GPR30 expression in MCF-7 cells was progestin specific and was not upregulated by...
... EcoRI digested pcDNA3 (Invitrogen) using T4 DNA Ligase (Invitrogen) pBABE-GFP and pBABE-GFP-vGPCR were propagated in Escherichia coli strain STBL2 (Invitrogen), whereas pcDNA3-vGPCR, pcDNA3, and ... Virology, Baltimore, MD) by BglII and EcoRI digestion [12] The digested vGPCR fragment was separated by gel electrophoresis, purified using QIAquick PCR Purification Kit (Qiagen, Page of (page number ... KSHV G- protein- coupled receptor (vGPCR) is a constitutively active lytic phase protein with significant homology to the human interleukin-8 (IL-8) receptor and has angiogenic and tumorigenic...
... EcoRI digested pcDNA3 (Invitrogen) using T4 DNA Ligase (Invitrogen) pBABE-GFP and pBABE-GFP-vGPCR were propagated in Escherichia coli strain STBL2 (Invitrogen), whereas pcDNA3-vGPCR, pcDNA3, and ... Virology, Baltimore, MD) by BglII and EcoRI digestion [12] The digested vGPCR fragment was separated by gel electrophoresis, purified using QIAquick PCR Purification Kit (Qiagen, Page of (page number ... KSHV G- protein- coupled receptor (vGPCR) is a constitutively active lytic phase protein with significant homology to the human interleukin-8 (IL-8) receptor and has angiogenic and tumorigenic...
... MasterPlus SYBR Green I mix (Roche Diagnostics) The following primers were used: muRGS1 5¢-TCTGCTAGCCCAAAGGATTC-3¢ (sense), 5¢TTCACGTCCATTCCAAAAGTC-3¢ (anti-sense); muRGS2 5¢-GAGAAAATGAAGCGGACACTCT-3¢ ... 5¢-GAGAAAATGAAGCGGACACTCT-3¢ (sense), 5¢-TTG CCAGTTTTGGGCTTC-3¢ (antisense); muHPRT as housekeeping gene 5¢-ACTTTGCTTTCCCTGGTTA-3¢ (sense), 5¢-CAAAGTCTGGCCTGTATCC-3¢ (antisense); muTNF-a 5¢-GACCCTCACACTCAGATCATCTTC-3¢ (sense), ... studies have shown that RGS proteins have GTPase activity and act as a GTPase activating protein (GAP) As a result, RGS proteins enhance GTP hydrolysis rates for purified Gai and Gaq subunits as much...
... among all the organelles, the Golgi bodies seem to show an abundance of G- proteins, involved in their biogenesis, trafficking, membrane organization, and many other important functions [16–19] G- proteins ... calcium ions is an emerging and interesting area for investigation In view of these observations, interactions between the Ca2+-binding protein Calnuc and signaling molecule G- proteins assume extreme ... binding of Mg2+ could not be detected Both Ca2+ and Mg2+ caused structural changes in the protein, to varying extents Studies on the proteinprotein 2530 interaction between Calnuc and G- protein...
... Chillakuri et al Precoupled form of human CB1 andGprotein trimer G CB1(417) +G Anti-Flag M2 IgG Receptor Anti-His tag IgG Receptor Anti-His tag IgG G Anti-Gi1/Gi2 IgG G containing only G proteins did ... restriction sites, was 5¢-GAA T GC GGC CGC TCA CTT TTC GAA TTG AGG GTG CGA CCA GAA TTC AGC CTC GGC AGA CGT GTC TGT GGA-3¢, which contains the StrepII tag between the EcoRI and NotI sites The reverse ... primer for the CB1 gene with the BamHI restriction site was 5¢-GC G GAT CC G ACC ATG GCG AAG TCG ATC CTA GAT GGC-3¢ The reverse primer for the full-length CB1 gene, with EcoRI and NotI restriction...
... tag (MGRSHHHHHHGYPYDVPDYAGS), with the last two amino acids (Gly-Ser) of the tag being generated by the insertion of a BamHI site A few constructs were tagged with a single HA tag (MGYPYDVPDYAGS) ... Ala screening of intracellular loops of the B2 receptor A Faussner et al G protein- coupledreceptors (GPCRs), and has been shown to be coupled preferably to Gprotein Gq ⁄ 11 Following activation, ... synthesized by Invitrogen and delivered desalted and lyophilized Gene mutagenesis, expression and cell culture Standard PCR techniques with primers designed accordingly and the B2Rwt gene as template...