g mip1b cells increases the sensitivity of the ics in comparison to the elispot

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Ngày tải lên : 13/08/2014, 13:20

... GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and GGCTTCTGCCAGTACTCGAGCCTTC (antisense) Primers used to produce SIVm3 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and TGGCTTCTGCCAGTACTCGAGCCTTTC ... levels in the CA and CA-SP1 bands in the pulse-chase assays of Gag processing shown in Fig Quantitative analysis of the 35S levels in the CA and CA-SP1 bands in the pulse-chase assays of Gag processing ... TAAGGCGCGCTTTATGGCCGGG (antisense mutagenic primer) The PCR product was digested with SpeI and ApaI and used to replace the corresponding fragment in pNL4-3 Primers used to produce SIVm2 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG...

10
194
0

History of Free Thought in Reference to The Christian Religion potx

Ngày tải lên : 16/03/2014, 03:20

... is the pledge of a future life Yet the use of these tests of intuition and feeling in religion, though possessing these advantages, has dangers If the feelings, instead of being used to reinforce ... vindicating the importance of investigating the history of free thought from the intellectual side, we admitted the necessity of taking the probability of the action of the moral element into ... formed In Milton, the appeal is made to the revelation of God in the Book; in Pope, to the revelation in Nature; in the living poet, to the revelation in man's soul, the type of the infinite Spirit...

332
442
0

Báo cáo khoa học: "Determining the placement of German verbs in English–to–German SMT" ppt

Ngày tải lên : 31/03/2014, 21:20

... simply invert the reordering rules which are applied on German as a source language in order to reorder the English input While the reordering of German implies movement of the German verbs into ... in order to move the German verbs into the positions corresponding to the positions of the English verbs Subsequently, the reordered German sentences are translated into English leading to better ... out in order to generate the reordered English sentences These are input for training a PSMT system or input to the decoder The processing steps are shown in ﬁgure For the development of the...

10
514
0

báo cáo hóa học: " Self-reported work ability of Norwegian women in relation to physical and mental health, and to the work environment" ppt

Ngày tải lên : 20/06/2014, 00:20

... Ethnicity was dichotomized according to whether the woman was born in Norway or not Marital status was dichotomized according to whether the woman was married/cohabitating or not Place of residence ... over the age of 51 years had the highest annual declining rate in work ability [2] For women, the physiological and mental changes associated with menopause and a general decline in abilities to ... environment continues to be physically demanding with aging, whereas men's becomes lighter [18,40] On the other hand, working in unskilled occupations can involve other risk factors for work ability...

9
428
0

báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

Ngày tải lên : 20/06/2014, 15:20

... according to eighteen strata [24] The probability of selecting an institution was inversely proportional to the number of institutions in its stratum and proportional to its number of beds Eight ... should be collected to confirm our findings It is interesting that a recent national survey of the UK system for delivering care to low vision subjects, involving a wide range of service providers, ... ophthalmologists/inhabitants and the prevalence of low vision, in France These data suggests that ophthalmologist density could be one of the drivers of good vision at a population level Competing interests...

8
445
0

báo cáo khoa học: " Upregulation of microRNA-451 increases cisplatin sensitivity of non-small cell lung cancer cell line (A549)" pot

Ngày tải lên : 10/08/2014, 10:21

... (5’-TGCTGAAACCGTTACCATTACTGAGTTGTTTTGG CCACTGACTGA- CAACTCAGTTGGTAACGGTTT-3’) and miR-451-precursor-R (5’-CCTGAAACCGTTACCA AC-TGAGTTGTCAGTCAGTGGCCAA AACAACTCAGTAATGGTAACGGTTTC-3’) was digested with BamHI and BglII and cloned into ... Dalian, China) For miRNA detection, mature miR-451 was reverse-transcribed with specific RT primers (miR-451: 5’-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAA-CTCAG-3’ and U6: 5’-TGGTGTCGTGGAGTCG-3’) quantified ... reverse, 5’-CTGGTGTCGTGGAGTCGGCAA-3’ U6 sense, 5’- CTCGCTTCGGCAGCACA-3’ and reverse, 5’AACGCTTCACGAATTTGCGT-3’ Then, the RT-PCR products were electrophoresed through a 1.5% agarose gel with ethidium...

11
564
0

Báo cáo khoa hoc:" Fusion of green fluorescent protein to the C-terminus of granulysin alters its intracellular localization in comparison to the native molecule" pptx

Ngày tải lên : 11/08/2014, 08:20

... However, the underlying molecular mechanisms governing their biogenesis and release remain less well understood Adaptation of GFP tagging technology to analyze these processes might therefore be of ... product in its regulated secretory compartment [6] Findings Stable transfectant lines for native granulysin, GFP-tagged granulysin, and non-fused GFP were derived using G4 18 selection The GFP proteins ... Conclusions to be drawn from these data regarding the mechanism(s) of sorting to cytolytic granules are limited but could suggest that altering the overall biophysical properties of granulysin by the...

3
269
0

báo cáo khoa học: " Transcriptome changes in the phenylpropanoid pathway of Glycine max in response to Pseudomonas syringae infection" ppsx

Ngày tải lên : 12/08/2014, 05:20

... restricted by the low levels of the F3H and transcripts of genes downstream of F3H, thus giving preference to the isoflavone/phytoalexin branch of the pathway during the response to infection The critical ... in further detail and compared to one another to gain an understanding of the timing in transcript accumulation changes occurring during the early hours post inoculation Table summarizes the hybridization ... together, the resulting transcript profiles obtained have shown that lignin/suberin biosyntheis appears to be the first response of the pathway in the infected soybean leaves judging by the higher...

18
354
0

The syntactic functions of english adjectives in comparison with those of VietNamese ones

Ngày tải lên : 06/10/2014, 15:48

70
476
1

Developing critical capacities for the efficient use of public investments in infrastructure to support trade and economic development in vietnam

Ngày tải lên : 10/09/2015, 09:01

... factors in the planning process and factors in the implementation process In the planning process, these factors include inadequate capacity for estimating and monitoring of rates of return of infrastructure ... failing to include other critical objectives of development, such as improving legal and human rights of the poor, slowing global warming, and leveraging the contributions of the private sector ... implication of the findings is that there is a strong need for the government to take the lead in ensuring that public investments in infrastructure lead to long-term and sustainable growth Practical...

392
562
0

The roles of shca proteins in response to oxidative stress 1

Ngày tải lên : 14/09/2015, 14:17

... Notice that the p27 is a negative image of the gel The experiments were done as in A Total RNA was isolated from the cells and RT-PCR was performed using a commercial kit -65- C p27 Actin 0.1 0.2 ... showing the activation of ERK1 and ERK2 combined -77- A B flag flag p46 Vec GST p46 Vec Vec p52 GST GST-p52 C Vec p52 GST-p46 D IP: flag(p52) IB: HA(p46) IP: HA(p46) IB: flag(p52) IB: flag(p52) ... Erk IB: p66 IP WCL IgG - + H2O2 WCL IgG - + H2O2 Figure 3.3A.B.C and D Interaction between ERK1 and p66shcA p66shcA (myc tagged) and ERK1 (HA tagged) were coexpressed in COS7 cells and co-IP experiments...

20
235
0

The roles of shca proteins in response to oxidative stress 2

Ngày tải lên : 14/09/2015, 14:18

... occurs during fragmentation (C) In vitro kinase assay shows that p52ShcA was phosphorylated by PKC δ at Ser29 GST-p52Shc (6KD fragment from N’terminus that distinguishes p52 from p46) and the mutant ... Levels of activated ERKs Fig 4.7 PKC inhibitors diminish H2O2 induced ERK activation (A) Wild type MEFs were pre-treated with different concentration of rottlerin or staurosporin for hr and the ... translocation of PKC δ and ShcA in response to H2O2 treatment COS7 cells were transfected with PKC δ-GFP, p52shc, or both for 48 hours and then treated with H2O2 Cells were then fixed, stained for...

10
257
0

Explore the influences of AR supported simulation on mutual engagement of social interaction in face to face collaborative learning for physics

Ngày tải lên : 05/10/2015, 22:15

... functions include initiating the negotiation of meaning, creating a shared reference in mean-making of the situation, and offering group memory for furthering elaborations Interacting with external ... extending the investigation of joint commitments in social interaction to the context of collaborative learning is beneficial for attaining an insight into the efficacy of the social process to ... of meaning is not merely the aggregation of independent meaning inserted by individuals, but the integration of meaning and the achievement of mutual understanding based on proceeding negotiations...

135
311
0

The syntactic functions of english adjectives in comparison with those of vietnamese ones

Ngày tải lên : 30/11/2015, 09:15

... language, for instance, there are likely to be no difficulties in using the language since the people involving in the process of communication are used to speaking their own native language ... On the other hand, if people taking part in the conversation speak different languages, they might face difficulties or obstacles in getting along with each other One of the problems causing the ... superlative From the beginning of this sector, I only focus on giving examples of positive adjectives functioning as attributive and then I am going to continue this point with the comparative adjectives...

71
2.9K
12

Tài liệu CURRENT R&D OF ADVANCED ROBOTS IN CHINAREPORT TO JCF’2002 OF IARPSOME CURRENT DEVELOPMENTS ppt

Ngày tải lên : 13/02/2014, 08:20

... cleaning work The robot can be controlled by the controlling box and the cable walking system stands on the top of the buildings Fig.2-3 Robot for cleaning station windows Fig.2-4 3W window cleaning ... CURRENT R&D OF ADVANCED ROBOTS IN CHINA REPORT TO JCF’2002 OF IARP Fig.2-2 Photo of the new type robot Fig.2-1 CLR-2 cleaning robot The institute of Robotics Research, Beijing Univ of Aeronautics and ... Astronautics has also done a project in the technology application of the wallclimbing robot The institute developed several types of wall cleaning robotics systems Fig 2-3 shows the glass ceiling robot...

7
381
0

Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea ﬂexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

Ngày tải lên : 20/02/2014, 23:20

... structure of T reesei xylanase with epoxyalkyl xylosides [35], the glycerol appears to mimic the binding of the xylose ring in the active site The binding of glycerol to a single site may suggest ... Engineering of multiple arginines into the Ser/Thr surface of Trichoderma reesei endo-1,4-beta-xylanase II increases the thermotolerance and shifts the pH optimum towards alkaline pH Protein ... proteins [36–38] The effect of the large-scale increase in the number of arginines was tested experimentally in T reesei xylanase II [39] These results showed that the introduction of ﬁve arginines...

14
520
0

BUSINESS AND Financial analysis OF BRITISH PETROLEUM WITH COMPARISON TO SHELL PLC

Ngày tải lên : 25/03/2014, 11:06

... look at the earning share as it is growing or shrinking The main thing is that the signals of long term strategies of the company in terms of financial matters If anything found during the analysis ... 2011 In this investigation the investigator had intended the surveys for gathering of the primary data keeping in opinion the economic and business examination The surveys in (Appendix II) are intended ... occupied the attention of the investigator to go through it for advance study After having a thorough study of the topic by the investigator the consideration of the researcher had been congregated...

84
400
1

Báo cáo lâm nghiệp: "Genetic variation of Prunus avium in susceptibility to cherry leaf spot (Blumeriella jaapii) in spatially heterogeneous infected seed orchards" docx

Ngày tải lên : 07/08/2014, 16:20

... subtracting the kriging estimates to the original values The kriging analysis was performed using the KRIG2D SAS procedure [28] An iterative procedure is needed because, if spatial heterogeneity ... among clones remained highly signiﬁcant when using bud burst as a covariate in the analyses, suggesting that other genetically controlled factors must be involved in this genetic resistance The ... variation is heritable The clonal material of the seed orchards should be further analyze by progeny testing in order to provide a further insight in the genetic inheritance of the disease resistance...

10
369
0

Báo cáo sinh học: "Breeding structure of Drosophila buzzatii in relation to competition in prickly pears (Opuntia ficus-indica)" potx

Ngày tải lên : 09/08/2014, 18:22

... melanogaster (Winter 0.002, P 0.006), the negative regression for D buzzatii suggesting that intraspecific competition is occurring within the breeding sites The negative correlation between the wing ... supplemented fruits with the expected values generated by various numbers of mating pairs contributing to a breeding site The main steps of our reasoning for disentangling the effects of drift and selection ... made to distinguish between females of these two species and their numbers were grouped together into a single class For each species that emerged from the two halves of the 63 fruits that remained...

16
243
0

Báo cáo y học: "volution of an adenocarcinoma in response to selection by targeted kinase inhibitors" potx

Ngày tải lên : 09/08/2014, 20:22

... Mycmediated apoptosis signaling, vascular endothelial growth factor (VEGF) signaling, phosphoinositide 3kinase (PI3K)/AKT signaling, and phosphatase and tensin homolog (PTEN) signaling, amongst others ... down-regulation of PTEN and up-regulation of the RET signaling pathway appear to be driving tumor proliferation Increased signaling independent of EGFR is consistent with the observed erlotinib insensitivity ... (Figure 2b) There are striking increases in expression of the receptor tyrosine kinases (EGFR, platelet-derived growth factor receptor (PDGFR)B) and their growth factor ligands (epidermal growth...

12
301
0