g mip 1b t cells increases the capacity to detect ifn g responses in ics
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx
... modality of evaluation equivalent to the measurement of the total IFN- γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity ... demonstrated that the new evaluation method based on the simultaneous detection of IFN- γ and MIP- 1β increased the capacity of the ICS to detect low-magnitude responses Discussion In the present study, ... positive using the ELISPOT as well, indicating that the increased sensitivity was not due to a higher number of false positive detections but due to a better capacity of the IFN- γ+ MIP- 1β+ data...
- 13
- 379
- 0
Báo cáo y học: " Pharyngeal oxygen administration increases the time to serious desaturation at intubation in acute lung injury: an experimental study" pot
... declare that they have no competing interests Authors' contributions JB participated in the design and acquisition of data, as well as helping to draft the manuscript GH participated in the design ... front toes If the anesthesia was deemed insufficient, fentanyl 0.2 mg was given intravenously During the first two hours, 10 ml kg-1h-1 Ringer's acetate was infused intravenously, and then the infusion ... Anesthesia was then maintained with ketamine 30 mg kg-1h-1 and The outline of the study is given in Figure After the instrumentation, arterial blood was sampled for measurement of oxygen tension,...
- 7
- 381
- 0
Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps
... CD25+CD4+ cells after stimulation through the TCR and might therefore mediate its effects in a membraneproximal manner [53] The level at which these anti-inflammatory cytokines operate to maintain tolerance ... Mason D: Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor beta and interleukin in the prevention of autoimmune thyroiditis in rats by peripheral ... Unfractionated CD4+ cells (which contain CD5high-expressing cells) prevented the induction of autoimmunity when transferred together with the CD5low cells, implying that the TR cells were contained specifically...
- 7
- 576
- 0
Báo cáo y học: "Development of proteoglycan-induced arthritis depends on T cell-supported autoantibody production, but does not involve significant influx of T cells into the joints." potx
... with adoptively transferred acute arthritis in the ankle) In contrast, anti-Gr-1 staining of sections of arthritic joints gave strong signals (Figure 2c), indicating that the majority of infiltrating ... of inflamed joints by flow cytometry Second, to determine whether the availability of T cells in the circulation affects their migration into the joints and arthritis development, we used FTY720, ... effector T cells can provide cytokine/chemokine stimuli to surrounding cells and act in concert with these cells to trigger and maintain a local inflammatory process [16,17] To address the importance...
- 16
- 211
- 0
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, increases the production of IL-1 receptor antagonist in human synovial fibroblasts and articular chondrocytes" ppsx
... different Taken together, these observations strongly suggest that, in addition to the inhibitory effect of A77 1726 on COX-2 activity and PGE2 production, other mechanisms contribute to its stimulatory ... shown to limit joint destruction and improve function scores significantly, and to a greater degree than with methotrexate, according to at least two studies [1,36] The mechanisms that result in this ... observed in joint cells in response to A77 1726, might therefore be potentially beneficial by contributing to prevent joint damage in inflammatory arthropathies such as RA In this regard, administration...
- 9
- 437
- 0
báo cáo khoa học: "mRNA detection of individual cells with the single cell nanoprobe method compared with in situ hybridization" doc
... inserted into the living cells to extract mRNAs Obtained mRNAs are subjected to RT-PCR and then to nested PCR or quantitative PCR Since the AFM has high positional and loading force control, extraction ... divided into classes within the range of -0.1 and 0.7 The center of each image is the position of the center of the AFM probe inserted β-actin mRNA was not detected in the region of Fig 3(a) whose ... -Log10 (In/ I0) I0 is the average of the background intensity In is the darkness intensity of each point of the cell In this equation, we considered (In/ I0) as the transmission Since the background...
- 6
- 331
- 0
Báo cáo y học: "Ultrasound has the potential to detect degeneration of articular cartilage clinically, even if the information is obtained from an indirect measurement of intrinsic physical characteristics" pdf
... information is obtained from an indirect measurement of the intrinsic physical characteristics Competing interests The authors declare that they have no competing interests References Zheng YP, ... Okamoto Y, Suzuki T, Nishitani K, Nakamura T: Ultrasound properties of articular cartilage in the tibio-femoral joint in knee osteoarthritis: relation to clinical assessment (International Cartilage ... of regenerated articular cartilage using wavelet transformation In Tissue Engineering for Therapeutic Use Edited by Ikada Y, Umakoshi Y, Hotta T Tokyo: Elsevier; 2002:133-142 Kuroki H, Nakagawa...
- 2
- 334
- 0
Báo cáo y học: "The challenge to detect heart transplant rejection and transplant vasculopathy non-invasively a pilot study" ppsx
... physiological saline solution were injected through an 18-gauge catheter into an antecubital vein to determine the circula- http://www.cardiothoracicsurgery.org/content/4/1/43 tion time The following ... extracellular contrast agent and the amount of contrast agent in a given tissue distribution volume determines the image signal intensity the more contrast per distribution volume the higher the signal An ... presented in our study utilizing a 16channel multidetector computed tomography scanner to evaluate the utility of computed tomography for the detection of coronary allograft vasculopathy, Romeo et...
- 9
- 399
- 0
Báo cáo khoa học: "Procalcitonin testing has the potential to reduce unnecessary antibiotic use in patients with suspected lower respiratory tract infections" ppsx
... concentrations of PCT are elevated in bacterial infections, but not in viral infections PCT levels have been used to determine the presence of bacterial infection in the setting of acute respiratory ... findings obtained by taking a thorough history and performing a careful physical examination The authors declare that they have no competing interests Christ-Crain M, Jaccard-Stolz D, Bingisser ... systemic or inhaled steroids prior to initial PCT determinations Steroids inhibit the secretion of numerous cytokines and other pro-inflammatory mediators, some which are strong inducers of PCT...
- 2
- 318
- 0
Báo cáo y học: "The struggle to detect circulating DNA" pps
... applications in measuring circulating DNA Assessment of circulatory DNA is a useful tool for predicting morbidity and mortality in patients admitted to the ICU Competing interests The author declares ... circulating DNA as a predictor for mortality and morbidity in patients admitted to the ICU Assessment of circulating DNA: real-time PCR versus immunological methods Quantification of circulating nucleosomes ... to 3,500 cells/ ml [2] Further improvement of the assay improved the detection limit to 1,000 cells/ ml Fully automated systems in DNA isolation, PCR mixture preparation and rapid thermal cycling...
- 3
- 251
- 0
The solutions to improve english writing skill in english k2012 at ca mau community college (CMCC
... of students in writing The teachers said that the students don t have good attitudes in studying writing It is important that also can affect to the students’ quality in this skill 4.2.3 The ... appear at the beginning It might be helpful to think of a topic sentence as working in two directions simultaneously It relates the paragraph to the essay's thesis, and thereby acts as a signpost for ... my investigation, they answered that the quality was bad Therefore, they can not overcome their tests Next, all the teachers responded that the quality of studying writing is so bad The following...
- 22
- 4,180
- 11
BUILDING THE CRITERIA TO EVALUATE TECHNICAL ADVANCED PROGRAMS IN VIETNAM
... objectives and requirements of the society in related to the mission, the conditions the program resources of the institution, pointing out the strengths and shortcomings, correction plan to develop ... the training program Training programs need the input of the individual for the adjustment and update of the actual requirements for training programs Criterion 2: The feedback on the quality ... of the institution Provide the institutional mission and vision statement of the university and faculties in consistency with training objectives Criteria 2: Training objectives and Student Outcomes...
- 27
- 363
- 0
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
... might precede RA? Genetic provocation of autoreactive T cells with low TCR signalling capacity The primary genetic defect in the SKG autoimmune arthritic mouse model is a point mutation in the TCR ... of how T cells with low TCR signalling capacity nevertheless interact with APCs and thus play initiating and continuing roles in the generation of autoimmune inflammation in RA patients An improved ... autoimmunity are characterized by defects in the normal process of either positive or negative selection, thus permitting the entry of autoreactive T cells into the peripheral repertoire In the periphery,...
- 9
- 406
- 0
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"
... Egger’s test to access the publication bias of literatures As shown in Fig 2, the shape of the funnel plots seemed symmetrical in the dominant genetic model for the -28C /G, suggesting that there ... the risk of the variant genotypes (GG/CG), compared with the wild-type genotype (CC) Then we calculated the ORs of the polymorphism (GG+CG versus CC, and GG versus CG+CC), using both dominant ... expression of the genes encoding chemokines rantes and mcp-3 in symptomatic atopic and nonatopic asthmatics: Relationship to the eosinophil-active cytokines interleukin (il)-5, granulocyte macrophage-colony-stimulating...
- 7
- 525
- 0
Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc
... before storage in a )80 °C freezer until required for analysis A primer template mix was prepared through the ligation of a tailor-made oligo template (T; 5¢-TTTGTT TGTTTGTTTGTTTGGGCGGTGGAGGCGG-3¢) ... City, CA, USA) The primer sequences were: b-actin (Fwd: 5¢-TCCTCCTGAGCGCAAGTACTC-3¢; Rev: 5¢-GCATTT GCGGTGGACGAT-3¢; Probe: 5¢-TGTGGATCAGCAAG CAGGAGTATGACGAGT-3¢) and Cyto B (Fwd: 5¢-CCG CTACCTTCACGCCAAT-3¢; ... for the dTTP pool, whereas the dATP and dCTP pools seemed to be highly regulated to maintain their levels The dGTP pool was increased in the H9 cells, but not in the CEM cells Defects in nucleotide...
- 11
- 506
- 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In ... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... IgG2b: sense primer 5¢-AAGCAG TGGTATCAACGCAGAGTACGCG-3¢ and reverse primer 5¢-GGACAGGGGTTGATTGTTGAAATGGG-3¢; light chain, clone 18 and 21, j: sense primer 5¢-CTAATAC GACTCACTATAGGGCAAGCAGTGGTATCAACGCA...
- 14
- 493
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
... first step for the investigation of multiprotein signaling complexes Functional studies in mice The structure ⁄ function studies of LAT gave initial insights into the link between the signaling ... [18,22,26] Together, this indicates that the formation of multiprotein signaling complexes at LAT is crucial for linking LAT phosphorylation to the stimulation of intracellular signaling pathways Yet, ... receptor-mediated signaling, degranulation and cytokine release, similar to those seen in LAT-deficient mice [39–41] Together, these data suggested that the ability of phosphorylated LAT to form signaling...
- 10
- 457
- 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx
... oligonucleotide encoding the NFAT binding site of the FasL promoter (5¢-ATTGTGGGCGGAAACTTCCAG-3¢) with additional GATC motifs at the 5¢ end into the BglII site of the pGL2-promoter (Promega, ... GAGCTCAGATACGTTGAC-3¢); and b-actin (forward: 5¢-CGTGGGCCGCCCTAGGCACCA-3¢,reverse: 5¢-TTG GCCTTAGGGTTCAGGGGGG-3¢ PCR cycling conditions were: de-naturation at 94 °C for 30 s, annealing at 52 °C ... 2002 glycerol The sequences of oligonucleotides used as probe in the experiments were: NFAT, 5¢-GATCATTGTGGGCG GAAACTTCC AG-3¢; and SP-1, 5¢-GATCGATCGGGG CGGGGCGAG-3¢ Immunofluorescence studies...
- 9
- 481
- 0
Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx
... using EcoRI, and ligated into EcoRI digested pGEX- 2T vector The SLP-76-Pro–GST plasmid was constructed using the primers 5¢-CGAGGGATCCCT GCAGAACTCCATCCTGCCTG-3¢ and 5¢-CATTTAAT GAATTCTCTTCCTCCGC-3¢ ... 5¢-GGAAGGATCCAATTCATTAAATGAAGA GTG-3¢ and 5¢-GGCTATAACGAATTCTGGGTACCC TGCAGCATG-3¢ This fragment was also cut with BamH1 and EcoR1 and ligated into pGEX-2TK The PAK-CDGST (PAK Crib domain) plasmid has ... Shb–PTB–GST plasmid was constructed using the primers 5¢-GGGATCCTTCCAGGACCCCTAC-3¢ and 5¢-AGAATTCAGGGCTCCCATGTTT-3¢ corresponding to the Shb cDNA nucleotides 840–1740 The amplified fragment was digested...
- 10
- 408
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25