g lt a s a b s s s a a a b b a s a b a a s a gt

Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

... GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG ... 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) ... nodes by reverse transcriptase polymerase chain reaction (RT-PCR) using the following primers: sense 5'-CGGGATCCCGATGGCTCTAACAA TGCTGC-3', antisense 5'-CGGAATTCCGCTTCGTGTGAAAGTATGGAG-3' The sense...

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Danh mục: Kỹ năng đọc tiếng Anh

... derivative was formed smoothly (80% yield from diol 22) It was pleasing to obtain this intermediate as beautiful crystals (mp 145–146 °C, hexane), after struggling through several stages with unstable ... ﬂexibility of this compound. 2a, 3a No spectrum of the natural compound was available for a direct comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone ... methylation to afford Danishefsky 4b, d and Mehta14 have shown that methylation of similar a, b- unsaturated ketones introduces the methyl group in a trans-orientation with respect to the angular methyl...

G.án K-S-Đ... Lớp5 tuan 7 CKTKN

Danh mục: Tư liệu khác

... bi -Ghi bng a H1 (lm vic c lp) Bc 1: Gi HS lờn ch bn a lớ t -3-4 HS lờn bng ch bn v trỡnh by nhiờn Vit Nam v mụ t v trớ gii hn ca -HS khỏc nhn xột, b sung nc ta trờn bn Bc 2: GV sa cha, giỳp ... giỳp HS hon thin phn ny b. H2: (Trũ chi i ỏp nhanh) -HS tham gia mi nhúm 5-6 HS Bc 1: Chn HS tham gia trũ chi, chia -Hai HS cú s th t ging thỡ ng thnh hai nhúm bng gn s cho mi i din HS -HS chi ... -Bit lm nhng vic c th t lũng bit n t tiờn II-Chun b: -GV: Tranh SGK, bng ph ghi BT1 -HS: su tm cõu ca dao, tc ng, th, truynnúi v lũng bit n t tiờn III-Cỏc hot ng dy hc GV HS Kim tra: -Gi HS...

george g. szpiro - kepler's conjecture

Danh mục: Vật lý

... way to stuff as many cannonballs into the hold of a ship as possible And thus a mathematical problem was born Harriot, Sir Walter s junior by eight years, was an accomplished mathematician, astronomer, ... three geometric forms could be compared in a fair manner After all, a large triangle has a bigger surface than a small hexagon What he probably meant was that when comparing squares, triangles, and ... hardly published anything Most of his scientific findings are contained in his magnum opus, Artis analyticae praxis ad Aequationes Algebraicas Resolvendas (Applications of the art of analysis...

.LONGMAN E N G L I S H GRAMMAR PRACTICE for intermediate students L. G. Alexander .Addison Wesley ppsx

Danh mục: Tài liệu khác

... Gymnasium Wildeshausen Robert Nowacek Italy Sandra Klapsis Joanna Malliou Homer Association, Athens George Rigas Greece Volkshochschule, Kaufbeuren The Morai'tis School, Athens Paola Giovamma ... just add an apostrophe (') This means: - add 's to singular nouns and names not ending in -s: a boy 's tie, Tom 's hat - add 's to singular nouns ending in -s: an actress 's career, a waitress 's ... acquired a simple vocabulary in the same way as babies do: through (babble) It is common (know) when babies that babble, it is a (prepare) speech When babies make for sounds like real...

semiconductors for micro and nanotechnology an introduction for engineers -korvink j. g., greiner a.

Danh mục: Vật lý

... the design and fabrication of a large variety of microsystems Therefore, this book is a great deal about silicon as a paradigm for semiconductors This of course implies that it is also about other ... Congress Card No.: applied for British Library Cataloguing-in-Publication Data: A catalogue record for this book is available from the British Library Die Deutsche Bibliothek — CIP-Cataloguing-in-Publication ... thermal energy implies a natural energy scale, at which the band gap energy of silicon of about 1.1 eV is rather large For high energy radiation of several keV the band gap energy again is negligible...

Professional android sensor programming (2012, milette g , stroud a )

Danh mục: Kỹ thuật lập trình

... techniques that are applicable in any app For example, the chapters in this book show you how to use BroadcastReceivers, Services, AsyncTasks, and databases for various tasks START SENSING! Apps can ... too small and has an awkward input mechanism Sensors also allow apps to amazing things For example, sensors can help save users from painfully slow manual input and manipulation, and sensors can ... this skill and make great apps that use sensors PROGRAMMING WITH ANDROID SENSORS Writing apps that use Android s sensors involves understanding the sensing capabilities of an Android device, selecting...

cole g.h.a., woolfson m.w. planetary science, the science of planets around stars

Danh mục: Vật lý

... decreasing mass is due to the increasing density of the DCC as it collapses More, but smaller and more energetic, turbulent streams are formed and the smaller Jeans mass enables lesser mass stars ... helium but also contains 1±2% by mass of solid grains that may be ices, silicates or metal Although it is so diuse, the ISM actually contains a signi®cant prtoportion of the mass of the galaxy ... are separated by a gap as though a planet is missing, but this gap is actually occupied by a large number of very small bodies These are the asteroids that will be discussed further in chapter...

g.an a.n 5 ph

Danh mục: Âm nhạc

... đồng ca : + Nhóm : xanh xanh quê.nơi + Nhóm : lung linh tơi thêm + Nhóm : rung rinh b n đờng + Nhóm : tung tăngtới trờng + Nhóm : bay xa quê ta + Nhóm : bay cao lao xao + Đồng ca : xanh tơi xanh ... Lắng nghe ghi nhớ Gia- rai, Ba-na, Xơ- đăng, Ê- đê, đồng b o Tây Nguyên ngời yêu lao động lạc quan, yêu đời B i Màu xanh quê hơng, dân ca Hrê em học hôm thể tình cảm vui tơi ngời dân Tây Nguyên ... =========================================**********====================================== giới thiệu hát:1 - GV giới thiệu tranh minh hoạ - Vùng đất Tây Nguyên có dân tộc nh Gia- rai, Ba-na, Xơ- đăng, Ê- đê , đồng b o Tây Nguyên ngời yêu lao động lạc quan, yêu đời B i Hát mừng,...

Burton g malkiel a random walk down wall street ing

Danh mục: PR - Truyền thông

... Conglomerate managers also found a new way of describing the businesses they had bought Their shipbuilding businesses became “marine systems.” Zinc mining became the “space minerals division.” Steel ... In and Strangles the Market Should We Have Known the Dangers? The U .S Housing Bubble and Crash of the Early 200 0s The New System of Banking Looser Lending Standards The Housing Bubble Bubbles and ... relatively risky military-hardware business, so its shares command a multiple of only 10 and sell at $100 Synergon offers to absorb Charlie Company on a share-for-share exchange basis Charlie’s...

318
2,994
3

Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps

Danh mục: Báo cáo khoa học

... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... DIS-R (5'CCTGTCTGAAGGGATGGTTGTAG3') RNA extraction, DNase treatment, and RT-PCR Viral RNA was extracted using the QIAamp viral RNA mini kit (Qiagen) Briefly, a 140 μl aliquot of unconcentrated ... reverse primers The primers VifF and VifR were used to amplify the Vif gene The dimer initiation site and beginning of gag was amplified using the primers DIS-F (5'GTCTGTTGTGTGACTCTGGTAAC3') and...

de thi toan.li.hoa.thpt lt A

Danh mục: Toán học

... 33 :S ng dùng s ng truyền hình s ng vô tuyến điện A. S ng ngắn B .S ng dài C .S ng cực ngắn D .S ng trung Câu 34:Đường nho g i đường A. Fuctozơ B. mantozơ c.saccarozơ D.Glucozơ Câu 35:Một mạch dao động ... 15:Phát biểu sau sai nói s ng điện từ A. S ng điện từ có tần s cao truyền xa B. Vận tốc truyền s ng điện từ không khí vận tốc ánh s ng C .S ng điện từ có tần s thấp không truyền xa D .b ớc s ng dài ... 25:Quang phổ vạch phát xạ phát A. Các chất rắn, lỏng khí b nung nóng B. Các chất rắn, lỏng khí có tỉ khối lớn b nung nóng C.chiếu ánh s ng trắng qua chất khí hay b nung nóng D chất khí hay áp suất...

The plancherel formula of l 2(n 0 GIpsi) where g is a p adic group

Danh mục: Cao đẳng - Đại học

... parabolic corresponds to a subset θ ⊂ ∆ Conversely, to each subset θ, one can associate a standard parabolic Pθ , Mθ , its Levi and If Pθ is a standard parabolic, we write its Langlands decomposition ... of standard parabolic subgroups and deﬁne a dense subspace of L2 (N0 \ G; ψ) which we will study in this paper Fix a minimal parabolic subgroup P0 as in the previous section A standard parabolic ... Contents Acknowledgments i Summary v Chapter 1.1 Introduction and statement of main results 1.2 The Cartan and Iwasawa decompositions of G 1.3 Parabolic subgroups and Schwartz spaces Chapter 2.1...

Pretest G.10 A G.9 2011

Danh mục: Tiếng anh

... electronic junk mail or spam, and personal information leaking A A A A A A A A quick popular thank wonderful reasons fashionable also feel B B B B B B B B slowly famous means enormous types commerce ... has limitations It is not only time-consuming and costly but (7)………… dangerous because of viruses and bad programs Moreover, Internet users sometimes have to (8)…………… various risks such as spam ... interesting The writer s friends have……………………… A B Same ideas A A B A A Nothing idea talking C Learning languages D traveling B Like/recycling C Dislike/charity D Volunteer/charity B orphans C...

Luyện thi vào 10 Chuyên đề Phương trình chứa GTTĐ

Danh mục: Toán học

... kiện để hai phương trình có nghiệm chung Ví dụ 1: Tìm m để hai phương trình sau x + mx + = x + x + m = có nghiệm chung tìm nghiệm chung Giải Giả s x0 nghiệm chung hai phương trình ta có x0 + ... ĐỀ GIẢI VÀ BIỆN LUẬN PHƯƠNG TRÌNH B C HAI I/ Dạng I tìm điều kiện để phương trình a. x + bx + c = có hai nghiệm phân biệt, chứng minh phương trình ln có nghiệm: 1) Phương pháp tính ∆ = b2 − 4ac ... Phương trình quy phương trình b c hai I/ Phương trình trùng phương ax + bx + c = phương pháp đặt x2 = t ( t >=0) ví dụ : Giải phương trình a) x − x − 12 = b) (1 − x )(1 + x ) + = II/ Phương trình...

Báo cáo khoa học: Control of transforming growth factor b signal transduction by small GTPases pot

Danh mục: Báo cáo khoa học

... 2957 TGFb signaling and small GTPases D Kardassis et al Non-Smad and Smad pathways in Rho GTPase activation by TGFb Certain studies have examined the participation of MAP kinases or the phosphatidylinositol ... abolished TGFb-induced actin reorganization in Swiss3T3 ﬁbroblasts and HaCaT keratinocytes (E Vasilaki, E Papadimitriou, C Stournaras and D Kardassis, unpublished results) TGFb also activates ... endosomes ⁄ lysosomes This issue has been investigated by overexpressing dominant-negative forms of Rab4 (Rab 4S2 2N) and Rab11 (Rab1 1S2 5N) and assessing TGFb receptor trafﬁcking [42] Rab4 regulates...

Tài liệu r e f e r e n c e p r a c t i c e a d v a n c e d o f b o o k a n d f o r l e a r n e r s E n g l pdf

Danh mục: Tài liệu khác

...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25